RLG00000018378

Belongs to the CTL (choline transporter-like) family

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Forward (+)
28965376 .. 28966413
1038 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000018378

Sequence Viewer

Length: 366 bp
ATGGGCAGCTCCGAAGAACCTAGCAAGCCCATCTCCCTCTACGACTCGTCGTCCACTCCCCTCCTCTCCAAACCCAACACGCCGCCAACTCATCCCTCTCTTTACTCCGACCAACCTGACTCGGACCCTACCCAGTACCTCCAGAACTCCTACAACCACGAACCTCATCCCTTCAAGGACCTCCCTTTCCTAATTCTCTTCCCCACCTTCGACATCGGAATCTTCATTGTCTTCCACCGCAACTCCGATTACTCCAGTCTCTCCTCCTACGAATACAACTCTGATTCCACCTCCTGCGTCAAGAACGCTTCTTCTTTCACTCCTGGGCTTGGCGGAGGAAGAGGGTTTCATGGCCTCCCTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

13.35

Weight (kDa)

5.06

Isoelectric Point (pI)

51.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 83, 238, 333
AfaI GTAC 1 cut(s) 137
AfiI CCNNNNNNNGG 1 cut(s) 329
AgsI TTSAA 1 cut(s) 175
AhdI GACNNNNNGTC 1 cut(s) 49
AjnI CCWGG 1 cut(s) 322
AluBI AGCT 1 cut(s) 9
AluI AGCT 1 cut(s) 9
Alw26I GTCTC 1 cut(s) 263
AoxI GGCC 1 cut(s) 352
ApeKI GCWGC 1 cut(s) 6
AspS9I GGNCC 2 cut(s) 124, 178
AvaII GGWCC 2 cut(s) 124, 178
BbsI GAAGAC 1 cut(s) 223
BbvI GCAGC 1 cut(s) 18
BccI CCATC 1 cut(s) 38
BciT130I CCWGG 1 cut(s) 324
BcoDI GTCTC 1 cut(s) 263
BfaI CTAG 2 cut(s) 21, 364
BisI GCNGC 2 cut(s) 7, 83
BlsI GCNGC 2 cut(s) 8, 84
Bme1390I CCNGG 1 cut(s) 324
Bme18I GGWCC 2 cut(s) 124, 178
BmeRI GACNNNNNGTC 1 cut(s) 49
BmgT120I GGNCC 2 cut(s) 124, 178
BmiI GGNNCC 1 cut(s) 126
BmrFI CCNGG 1 cut(s) 324
BmrI ACTGGG 1 cut(s) 127
BmuI ACTGGG 1 cut(s) 127
BpiI GAAGAC 1 cut(s) 223
BpmI CTGGAG 2 cut(s) 125, 238
BsaJI CCNNGG 1 cut(s) 323
BsaXI ACNNNNNCTCC 2 cut(s) 227, 257
Bsc4I CCNNNNNNNGG 1 cut(s) 329
Bse1I ACTGG 2 cut(s) 133, 255
BseBI CCWGG 1 cut(s) 324
BseDI CCNNGG 1 cut(s) 323
BseGI GGATG 2 cut(s) 91, 166
BseLI CCNNNNNNNGG 1 cut(s) 329
BseNI ACTGG 2 cut(s) 133, 255
BseRI GAGGAG 2 cut(s) 53, 253
BseXI GCAGC 1 cut(s) 18
BshFI GGCC 1 cut(s) 354
BslI CCNNNNNNNGG 1 cut(s) 329
BsmAI GTCTC 1 cut(s) 263
BsnI GGCC 1 cut(s) 354
BspACI CCGC 3 cut(s) 83, 238, 333
BspANI GGCC 1 cut(s) 354
BspLI GGNNCC 1 cut(s) 126
BsrI ACTGG 2 cut(s) 133, 255
BssECI CCNNGG 1 cut(s) 323
Bst2UI CCWGG 1 cut(s) 324
Bst6I CTCTTC 2 cut(s) 203, 334
BstC8I GCNNGC 1 cut(s) 26
BstF5I GGATG 2 cut(s) 91, 166
BstMAI GTCTC 1 cut(s) 263
BstNI CCWGG 1 cut(s) 324
BstSCI CCNGG 1 cut(s) 322
BstV1I GCAGC 1 cut(s) 18
BstV2I GAAGAC 1 cut(s) 223
BsuRI GGCC 1 cut(s) 354
BtsCI GGATG 2 cut(s) 91, 166
Cac8I GCNNGC 1 cut(s) 26
Cfr13I GGNCC 2 cut(s) 124, 178
CseI GACGC 1 cut(s) 286
Csp6I GTAC 1 cut(s) 136
CviAII CATG 1 cut(s) 350
CviJI RGCY 4 cut(s) 9, 28, 328, 354
CviKI_1 RGCY 4 cut(s) 9, 28, 328, 354
CviQI GTAC 1 cut(s) 136
DriI GACNNNNNGTC 1 cut(s) 49
Eam1104I CTCTTC 2 cut(s) 203, 334
Eam1105I GACNNNNNGTC 1 cut(s) 49
EarI CTCTTC 2 cut(s) 203, 334
EciI GGCGGA 1 cut(s) 348
Eco47I GGWCC 2 cut(s) 124, 178
EcoO109I RGGNCCY 1 cut(s) 178
EcoRII CCWGG 1 cut(s) 322
FaeI CATG 1 cut(s) 353
FaiI YATR 1 cut(s) 351
FatI CATG 1 cut(s) 349
Fnu4HI GCNGC 2 cut(s) 7, 83
FokI GGATG 2 cut(s) 78, 153
Fsp4HI GCNGC 2 cut(s) 7, 83
FspBI CTAG 2 cut(s) 21, 364
GluI GCNGC 2 cut(s) 7, 83
GsuI CTGGAG 2 cut(s) 125, 238
HaeIII GGCC 1 cut(s) 354
HgaI GACGC 1 cut(s) 286
Hin1II CATG 1 cut(s) 353
HinfI GANTC 4 cut(s) 44, 119, 219, 284
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 6 cut(s) 13, 109, 124, 218, 247, 283
Hpy188III TCNNGA 2 cut(s) 142, 301
Hpy8I GTNNAC 1 cut(s) 54
Hpy99I CGWCG 1 cut(s) 52
HpyAV CCTTC 2 cut(s) 181, 217
Hsp92II CATG 1 cut(s) 353
LmnI GCTCC 1 cut(s) 14
LpnPI CCDG 7 cut(s) 129, 146, 155, 268, 307, 309, 336
Lsp1109I GCAGC 1 cut(s) 18
MaeI CTAG 2 cut(s) 21, 364
MboII GAAGA 6 cut(s) 26, 190, 214, 223, 303, 351
MluCI AATT 1 cut(s) 192
MlyI GAGTC 2 cut(s) 38, 113
MmeI TCCRAC 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 324
MvaI CCWGG 1 cut(s) 324
NlaIII CATG 1 cut(s) 353
NlaIV GGNNCC 1 cut(s) 126
PfeI GAWTC 2 cut(s) 219, 284
PkrI GCNGC 2 cut(s) 8, 84
PleI GAGTC 2 cut(s) 38, 113
PpsI GAGTC 2 cut(s) 38, 113
PpuMI RGGWCCY 1 cut(s) 178
Psp5II RGGWCCY 1 cut(s) 178
Psp6I CCWGG 1 cut(s) 322
PspGI CCWGG 1 cut(s) 322
PspN4I GGNNCC 1 cut(s) 126
PspPI GGNCC 2 cut(s) 124, 178
PspPPI RGGWCCY 1 cut(s) 178
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
SatI GCNGC 2 cut(s) 7, 83
Sau96I GGNCC 2 cut(s) 124, 178
SchI GAGTC 2 cut(s) 38, 113
ScrFI CCNGG 1 cut(s) 324
SetI ASST 8 cut(s) 11, 22, 118, 141, 166, 183, 209, 293
SinI GGWCC 2 cut(s) 124, 178
Sse9I AATT 1 cut(s) 192
SsiI CCGC 3 cut(s) 83, 238, 333
SspMI CTAG 2 cut(s) 21, 364
StyD4I CCNGG 1 cut(s) 322
TaqI TCGA 1 cut(s) 210
TasI AATT 1 cut(s) 192
TauI GCSGC 1 cut(s) 85
TfiI GAWTC 2 cut(s) 219, 284
TseI GCWGC 1 cut(s) 6
TspDTI ATGAA 2 cut(s) 214, 338
VpaK11BI GGWCC 2 cut(s) 124, 178
XspI CTAG 2 cut(s) 21, 364
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.