RLG00000030108

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
55406801 .. 55408126
1326 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030108

Sequence Viewer

Length: 372 bp
ATGGGGCAAGGTATGAGCTTGGGGTCTGTTATGGTGCTGGCGGGTCTAGCGGCTTTCATGGTGGTGCTGCCGTTAATGCTGCCTCCGCTGCCTCCTCCGCCGCTGATGTTCTTGTTCTTTCCGGTAGGGATAATGGCCGCCCTCATGTTTCTGGCTTTCTCTCCTGCCGATAACGTTATGCTTTACAGCTTTAAAGCTTTTGCTGCTGTCCTGCTTTTCTCCGGTGGTCTCCGAGTGTCAATTGTCACTACCACCACCATTGCTGGCCAAACCACCACCGTCAATGCTGATCAGACTAGCACTGTCACTGCAGGCCAAGCCATCACCACCGCTTGCATCCCAAGGCAATTCGCTGCTTGCTTGATAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

12.79

Weight (kDa)

7.81

Isoelectric Point (pI)

39.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 7 cut(s) 41, 50, 86, 98, 101, 138, 330
AclI AACGTT 1 cut(s) 174
AcoI YGGCCR 2 cut(s) 135, 265
AluBI AGCT 3 cut(s) 18, 189, 197
AluI AGCT 3 cut(s) 18, 189, 197
Alw26I GTCTC 1 cut(s) 233
AoxI GGCC 3 cut(s) 135, 265, 313
ApeKI GCWGC 5 cut(s) 67, 79, 88, 203, 353
AsuHPI GGTGA 1 cut(s) 316
BalI TGGCCA 1 cut(s) 267
BbvI GCAGC 5 cut(s) 54, 66, 75, 190, 340
BccI CCATC 1 cut(s) 329
BceAI ACGGC 1 cut(s) 55
BclI TGATCA 1 cut(s) 289
BcoDI GTCTC 1 cut(s) 233
BfaI CTAG 2 cut(s) 47, 297
BfmI CTRYAG 1 cut(s) 309
BisI GCNGC 8 cut(s) 51, 68, 80, 89, 101, 138, 204, 354
BlsI GCNGC 8 cut(s) 52, 69, 81, 90, 102, 139, 205, 355
BmsI GCATC 1 cut(s) 345
BsaI GGTCTC 1 cut(s) 233
BsaJI CCNNGG 1 cut(s) 341
BsaWI WCCGGW 2 cut(s) 121, 221
Bse3DI GCAATG 1 cut(s) 258
BseDI CCNNGG 1 cut(s) 341
BseGI GGATG 1 cut(s) 336
BseMI GCAATG 1 cut(s) 258
BseRI GAGGAG 1 cut(s) 84
BseXI GCAGC 5 cut(s) 54, 66, 75, 190, 340
BshFI GGCC 3 cut(s) 137, 267, 315
BsiSI CCGG 2 cut(s) 122, 222
BsmAI GTCTC 1 cut(s) 233
BsnI GGCC 3 cut(s) 137, 267, 315
Bso31I GGTCTC 1 cut(s) 233
Bsp143I GATC 1 cut(s) 289
BspACI CCGC 7 cut(s) 41, 50, 86, 98, 101, 138, 330
BspANI GGCC 3 cut(s) 137, 267, 315
BspMAI CTGCAG 1 cut(s) 313
BspTNI GGTCTC 1 cut(s) 233
BsrDI GCAATG 1 cut(s) 258
BssECI CCNNGG 1 cut(s) 341
BssMI GATC 1 cut(s) 289
BssT1I CCWWGG 1 cut(s) 341
Bst4CI ACNGT 2 cut(s) 280, 304
BstC8I GCNNGC 5 cut(s) 39, 265, 313, 334, 358
BstF5I GGATG 1 cut(s) 336
BstKTI GATC 1 cut(s) 292
BstMAI GTCTC 1 cut(s) 233
BstMBI GATC 1 cut(s) 289
BstMWI GCNNNNNNNGC 7 cut(s) 47, 76, 85, 88, 97, 203, 317
BstSFI CTRYAG 1 cut(s) 309
BstV1I GCAGC 5 cut(s) 54, 66, 75, 190, 340
BsuRI GGCC 3 cut(s) 137, 267, 315
BtsCI GGATG 1 cut(s) 336
BtsI GCAGTG 1 cut(s) 306
BtsIMutI CAGTG 2 cut(s) 300, 306
Cac8I GCNNGC 5 cut(s) 39, 265, 313, 334, 358
CspCI CAANNNNNGTGG 2 cut(s) 241, 276
CviAII CATG 2 cut(s) 58, 145
CviJI RGCY 9 cut(s) 18, 53, 137, 155, 189, 197, 267, 315, 320
CviKI_1 RGCY 9 cut(s) 18, 53, 137, 155, 189, 197, 267, 315, 320
DpnI GATC 1 cut(s) 291
DpnII GATC 1 cut(s) 289
DraI TTTAAA 1 cut(s) 193
EaeI YGGCCR 2 cut(s) 135, 265
EciI GGCGGA 1 cut(s) 87
Eco130I CCWWGG 1 cut(s) 341
Eco31I GGTCTC 1 cut(s) 233
EcoT14I CCWWGG 1 cut(s) 341
ErhI CCWWGG 1 cut(s) 341
FaeI CATG 2 cut(s) 61, 148
FaiI YATR 5 cut(s) 14, 32, 59, 146, 179
FatI CATG 2 cut(s) 57, 144
FauI CCCGC 1 cut(s) 34
FbaI TGATCA 1 cut(s) 289
Fnu4HI GCNGC 8 cut(s) 51, 68, 80, 89, 101, 138, 204, 354
FokI GGATG 1 cut(s) 323
Fsp4HI GCNGC 8 cut(s) 51, 68, 80, 89, 101, 138, 204, 354
FspBI CTAG 2 cut(s) 47, 297
GluI GCNGC 8 cut(s) 51, 68, 80, 89, 101, 138, 204, 354
HaeIII GGCC 3 cut(s) 137, 267, 315
HapII CCGG 2 cut(s) 122, 222
Hin1II CATG 2 cut(s) 61, 148
HindIII AAGCTT 1 cut(s) 195
HpaII CCGG 2 cut(s) 122, 222
HphI GGTGA 1 cut(s) 316
Hpy188I TCNGA 2 cut(s) 233, 294
HpyCH4III ACNGT 2 cut(s) 280, 304
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 2 cut(s) 311, 336
HpyF10VI GCNNNNNNNGC 7 cut(s) 47, 76, 85, 88, 97, 203, 317
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 2 cut(s) 61, 148
Ksp22I TGATCA 1 cut(s) 289
Kzo9I GATC 1 cut(s) 289
LpnPI CCDG 8 cut(s) 23, 135, 137, 177, 224, 235, 249, 297
Lsp1109I GCAGC 5 cut(s) 54, 66, 75, 190, 340
LweI GCATC 1 cut(s) 345
MaeI CTAG 2 cut(s) 47, 297
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 2 cut(s) 244, 304
MalI GATC 1 cut(s) 291
MboI GATC 1 cut(s) 289
MfeI CAATTG 1 cut(s) 240
MlsI TGGCCA 1 cut(s) 267
MluCI AATT 2 cut(s) 240, 347
MluNI TGGCCA 1 cut(s) 267
MnlI CCTC 4 cut(s) 93, 102, 105, 152
Mox20I TGGCCA 1 cut(s) 267
MscI TGGCCA 1 cut(s) 267
MseI TTAA 2 cut(s) 74, 192
MslI CAYNNNNRTG 1 cut(s) 62
Msp20I TGGCCA 1 cut(s) 267
MspA1I CMGCKG 2 cut(s) 88, 103
MspI CCGG 2 cut(s) 122, 222
MunI CAATTG 1 cut(s) 240
MwoI GCNNNNNNNGC 7 cut(s) 47, 76, 85, 88, 97, 203, 317
NdeII GATC 1 cut(s) 289
NlaIII CATG 2 cut(s) 61, 148
NmuCI GTSAC 2 cut(s) 244, 304
PkrI GCNGC 8 cut(s) 52, 69, 81, 90, 102, 139, 205, 355
Psp1406I AACGTT 1 cut(s) 174
PstI CTGCAG 1 cut(s) 313
RseI CAYNNNNRTG 1 cut(s) 62
SaqAI TTAA 2 cut(s) 74, 192
SatI GCNGC 8 cut(s) 51, 68, 80, 89, 101, 138, 204, 354
Sau3AI GATC 1 cut(s) 289
SetI ASST 5 cut(s) 13, 20, 177, 191, 199
SfaNI GCATC 1 cut(s) 345
SfcI CTRYAG 1 cut(s) 309
SmiMI CAYNNNNRTG 1 cut(s) 62
Sse9I AATT 2 cut(s) 240, 347
SsiI CCGC 7 cut(s) 41, 50, 86, 98, 101, 138, 330
SspMI CTAG 2 cut(s) 47, 297
StyI CCWWGG 1 cut(s) 341
TaaI ACNGT 2 cut(s) 280, 304
TaiI ACGT 1 cut(s) 177
TasI AATT 2 cut(s) 240, 347
TauI GCSGC 3 cut(s) 53, 103, 140
Tru1I TTAA 2 cut(s) 74, 192
Tru9I TTAA 2 cut(s) 74, 192
TscAI CASTG 2 cut(s) 307, 313
TseFI GTSAC 2 cut(s) 244, 304
TseI GCWGC 5 cut(s) 67, 79, 88, 203, 353
Tsp45I GTSAC 2 cut(s) 244, 304
TspDTI ATGAA 1 cut(s) 46
TspRI CASTG 2 cut(s) 307, 313
XspI CTAG 2 cut(s) 47, 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.