RLG00000034737

Chloroplastic group IIA intron splicing facilitator CRS1

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
53207266 .. 53208319
1054 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034737

Sequence Viewer

Length: 315 bp
ATGAACAAAATTGTGGAGAAATTAAAGAAATTTGGGTACATTACGGCGAATAAGAATGAGGATAAAGGTCAAGTGAGAGAGAGAGTGATCGAAAAAGGTTCTGTGGAGGATATATTTTATGTTGAGGAAGGAATGTTGCCGAATTCTAGAGGTGGGTTATCGGCAGAATCGCCATTAGGGGTGGAGAATGTGTTTGGAGATGATGGTGGTTGTGAGGTTTTGAATTTTGCTGTCTTCCCAGAACCAGAATTTGATATGCCAATATTTTGTGCCAACTTCTTCACCAGTGCGAATGGGAACATAATTGTGCTGTAA

Protein Analysis

105

Amino Acids

11.48

Weight (kDa)

4.51

Isoelectric Point (pI)

43.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Fe_bilin_red PF05996 71 - 103 5.4e-08 Ferredoxin-dependent bilin reductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 29, 142, 223, 248
AfaI GTAC 1 cut(s) 38
AgsI TTSAA 1 cut(s) 223
ApoI RAATTY 4 cut(s) 29, 142, 223, 248
AsuHPI GGTGA 1 cut(s) 274
BbsI GAAGAC 1 cut(s) 226
BccI CCATC 1 cut(s) 197
BceAI ACGGC 1 cut(s) 60
BfaI CTAG 1 cut(s) 147
BpiI GAAGAC 1 cut(s) 226
BsaXI ACNNNNNCTCC 2 cut(s) 176, 206
Bse1I ACTGG 1 cut(s) 285
BseNI ACTGG 1 cut(s) 285
Bsp143I GATC 1 cut(s) 87
BsrI ACTGG 1 cut(s) 285
BssMI GATC 1 cut(s) 87
BstKTI GATC 1 cut(s) 90
BstMBI GATC 1 cut(s) 87
BstV2I GAAGAC 1 cut(s) 226
BtsIMutI CAGTG 1 cut(s) 292
Csp6I GTAC 1 cut(s) 37
CviQI GTAC 1 cut(s) 37
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
EcoRI GAATTC 1 cut(s) 142
FaiI YATR 4 cut(s) 113, 120, 257, 302
FspBI CTAG 1 cut(s) 147
HinfI GANTC 1 cut(s) 167
HphI GGTGA 1 cut(s) 274
Hpy188III TCNNGA 1 cut(s) 147
HpyAV CCTTC 1 cut(s) 122
Kzo9I GATC 1 cut(s) 87
LpnPI CCDG 3 cut(s) 252, 258, 298
MaeI CTAG 1 cut(s) 147
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 2 cut(s) 226, 271
MluCI AATT 7 cut(s) 9, 20, 29, 142, 223, 248, 303
MnlI CCTC 5 cut(s) 52, 100, 118, 143, 208
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 305
NdeII GATC 1 cut(s) 87
PfeI GAWTC 1 cut(s) 167
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
RseI CAYNNNNRTG 1 cut(s) 305
SaqAI TTAA 1 cut(s) 23
Sau3AI GATC 1 cut(s) 87
SetI ASST 4 cut(s) 70, 100, 154, 219
SgeI CNNG 5 cut(s) 83, 159, 251, 257, 297
SmiMI CAYNNNNRTG 1 cut(s) 305
Sse9I AATT 7 cut(s) 9, 20, 29, 142, 223, 248, 303
SspI AATATT 1 cut(s) 264
SspMI CTAG 1 cut(s) 147
TaqI TCGA 1 cut(s) 90
TasI AATT 7 cut(s) 9, 20, 29, 142, 223, 248, 303
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TscAI CASTG 1 cut(s) 292
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 292
XapI RAATTY 4 cut(s) 29, 142, 223, 248
XbaI TCTAGA 1 cut(s) 146
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.