Rroxscaffold_1G00029910

Phytochromobilin ferredoxin oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
38929281 .. 38930222
942 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00029910.1

Sequence Viewer

Length: 213 bp
ATGGAGGATATATTTTATGTTGAGGAAGGAATGTTGTCGAATTCTAGAGGTGAGTTATCGGCAGAATCGCCACTAGGGGTGGAGAATGTGTTTGGAGATGATGGTGGTGGTGAGGTTTTGAATTTTGCTGTCTTCCCAGAACCAGAATTTGATCTGCCAATATTTTGTGCCAACTTCTTCACCAGTGCAAATGGGAACATAGTTGTGCTGTAA

Protein Analysis

70

Amino Acids

7.57

Weight (kDa)

4.05

Isoelectric Point (pI)

46.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Fe_bilin_red PF05996 38 - 69 2.9e-08 Ferredoxin-dependent bilin reductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 40, 121, 146
AgsI TTSAA 1 cut(s) 121
ApoI RAATTY 3 cut(s) 40, 121, 146
AsuHPI GGTGA 3 cut(s) 62, 122, 172
BbsI GAAGAC 1 cut(s) 124
BccI CCATC 1 cut(s) 95
BfaI CTAG 2 cut(s) 45, 74
BpiI GAAGAC 1 cut(s) 124
BsaXI ACNNNNNCTCC 2 cut(s) 74, 104
Bse1I ACTGG 1 cut(s) 183
BseNI ACTGG 1 cut(s) 183
Bsp143I GATC 1 cut(s) 151
BsrI ACTGG 1 cut(s) 183
BssMI GATC 1 cut(s) 151
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BstV2I GAAGAC 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 190
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
EcoRI GAATTC 1 cut(s) 40
FaiI YATR 3 cut(s) 11, 18, 200
FspBI CTAG 2 cut(s) 45, 74
HinfI GANTC 1 cut(s) 65
HphI GGTGA 3 cut(s) 62, 122, 172
Hpy188III TCNNGA 1 cut(s) 45
HpyAV CCTTC 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 188
Kzo9I GATC 1 cut(s) 151
LpnPI CCDG 3 cut(s) 150, 156, 196
MaeI CTAG 2 cut(s) 45, 74
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 2 cut(s) 124, 169
MluCI AATT 3 cut(s) 40, 121, 146
MnlI CCTC 3 cut(s) 16, 41, 106
MslI CAYNNNNRTG 1 cut(s) 203
NdeII GATC 1 cut(s) 151
PfeI GAWTC 1 cut(s) 65
RseI CAYNNNNRTG 1 cut(s) 203
Sau3AI GATC 1 cut(s) 151
SetI ASST 2 cut(s) 52, 117
SgeI CNNG 5 cut(s) 57, 86, 149, 155, 195
SmiMI CAYNNNNRTG 1 cut(s) 203
Sse9I AATT 3 cut(s) 40, 121, 146
SspI AATATT 1 cut(s) 162
SspMI CTAG 2 cut(s) 45, 74
TaqI TCGA 1 cut(s) 38
TasI AATT 3 cut(s) 40, 121, 146
TfiI GAWTC 1 cut(s) 65
TscAI CASTG 1 cut(s) 190
TspRI CASTG 1 cut(s) 190
XapI RAATTY 3 cut(s) 40, 121, 146
XbaI TCTAGA 1 cut(s) 44
XspI CTAG 2 cut(s) 45, 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.