Rmu_co7980486.1_g000001

RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7980486.1
Physical Location & Seq
Reverse (-)
2 .. 374
373 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7980486.1_g000001.1.cds

Sequence Viewer

Length: 216 bp
atgcctcgatacaaagatgaacctcctgctgttcgtgtttacacagtctgtgacgaatcaaggtatttgatagtgaggaatgttccatctttgggatgcggtgatgagctgttgacgctgttctcatcctatggagatgtagaggagtgtaaaccaatggatgcagaagattgtgagcaattcactgatgtttactggataaagtttcgtcttgtc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.4

Weight (kDa)

4.4

Isoelectric Point (pI)

43.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 92
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
AsuHPI GGTGA 1 cut(s) 113
BccI CCATC 1 cut(s) 94
BmsI GCATC 2 cut(s) 86, 151
Bsc4I CCNNNNNNNGG 1 cut(s) 92
Bse1I ACTGG 1 cut(s) 200
BseGI GGATG 3 cut(s) 101, 125, 166
BseLI CCNNNNNNNGG 1 cut(s) 92
BseNI ACTGG 1 cut(s) 200
BseRI GAGGAG 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 92
BspACI CCGC 1 cut(s) 99
BsrI ACTGG 1 cut(s) 200
Bst4CI ACNGT 1 cut(s) 46
BstF5I GGATG 3 cut(s) 101, 125, 166
BstMWI GCNNNNNNNGC 1 cut(s) 115
BtsCI GGATG 3 cut(s) 101, 125, 166
BtsIMutI CAGTG 1 cut(s) 183
CseI GACGC 1 cut(s) 124
CviJI RGCY 1 cut(s) 109
CviKI_1 RGCY 1 cut(s) 109
FaiI YATR 1 cut(s) 132
FokI GGATG 3 cut(s) 108, 112, 173
HgaI GACGC 1 cut(s) 124
HincII GTYRAC 1 cut(s) 114
HindII GTYRAC 1 cut(s) 114
HinfI GANTC 1 cut(s) 56
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 4 cut(s) 40, 114, 152, 193
Hpy8I GTNNAC 4 cut(s) 40, 114, 152, 193
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 1 cut(s) 115
LpnPI CCDG 2 cut(s) 39, 181
LweI GCATC 2 cut(s) 86, 151
MaeIII GTNAC 1 cut(s) 50
MboII GAAGA 1 cut(s) 179
MluCI AATT 1 cut(s) 179
MnlI CCTC 4 cut(s) 15, 33, 69, 136
MwoI GCNNNNNNNGC 1 cut(s) 115
NmuCI GTSAC 1 cut(s) 50
PfeI GAWTC 1 cut(s) 56
SetI ASST 3 cut(s) 25, 65, 111
SfaNI GCATC 2 cut(s) 86, 151
SgeI CNNG 5 cut(s) 18, 38, 47, 72, 208
Sse9I AATT 1 cut(s) 179
SsiI CCGC 1 cut(s) 99
TaaI ACNGT 1 cut(s) 46
TaqI TCGA 1 cut(s) 7
TasI AATT 1 cut(s) 179
TfiI GAWTC 1 cut(s) 56
TscAI CASTG 1 cut(s) 190
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 33
TspRI CASTG 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.