Rmu_sc0039274.1_g000001

RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039274.1
Physical Location & Seq
Reverse (-)
1 .. 804
804 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039274.1_g000001.1.cds

Sequence Viewer

Length: 396 bp
atggatgcagaagattgtgagcaattcactgatgtttactggataaagtttcgtcttgtcaacaacgccaggtttgcaaagaggaagttagacgagtatgttttccttggaaatcgactgggggtttcatatgctcctcagtttgagagccttgccgacacaaaggacaaactggaaggcaggagaagagaagttctagcacggttgaacccttgtggttctaaagggtccagagttaacaagtcaggtgctttaaccgaggtttcgttcgatgcaaccccatcccagacttacagcgattcccaacgtgtaaactgtagcccaagggactatggacaatcacaacttacttcgcaagttaataatcctcccattacaagagtttcctctgagaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.95

Weight (kDa)

8.82

Isoelectric Point (pI)

43.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 307
AgsI TTSAA 1 cut(s) 208
AjnI CCWGG 1 cut(s) 68
AspS9I GGNCC 1 cut(s) 228
AvaII GGWCC 1 cut(s) 228
BccI CCATC 1 cut(s) 289
BciT130I CCWGG 1 cut(s) 70
BfaI CTAG 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 316
Bme1390I CCNGG 1 cut(s) 70
Bme18I GGWCC 1 cut(s) 228
BmgT120I GGNCC 1 cut(s) 228
BmiI GGNNCC 1 cut(s) 229
BmrFI CCNGG 1 cut(s) 70
BmrI ACTGGG 1 cut(s) 128
BmsI GCATC 1 cut(s) 262
BmuI ACTGGG 1 cut(s) 128
BsaJI CCNNGG 3 cut(s) 106, 258, 323
Bse1I ACTGG 3 cut(s) 44, 123, 177
BseBI CCWGG 1 cut(s) 70
BseDI CCNNGG 3 cut(s) 106, 258, 323
BseGI GGATG 2 cut(s) 10, 281
BseMII CTCAG 2 cut(s) 152, 381
BseNI ACTGG 3 cut(s) 44, 123, 177
BseRI GAGGAG 1 cut(s) 126
BslFI GGGAC 1 cut(s) 341
BsmFI GGGAC 1 cut(s) 341
BspCNI CTCAG 2 cut(s) 151, 382
BspLI GGNNCC 1 cut(s) 229
BsrI ACTGG 3 cut(s) 44, 123, 177
BssECI CCNNGG 3 cut(s) 106, 258, 323
BssT1I CCWWGG 2 cut(s) 106, 323
Bst2UI CCWGG 1 cut(s) 70
Bst4CI ACNGT 2 cut(s) 204, 317
Bst6I CTCTTC 1 cut(s) 181
BstDEI CTNAG 2 cut(s) 138, 390
BstF5I GGATG 2 cut(s) 10, 281
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 70
BstSCI CCNGG 1 cut(s) 68
BstSFI CTRYAG 1 cut(s) 316
BtsCI GGATG 2 cut(s) 10, 281
BtsIMutI CAGTG 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 228
CviJI RGCY 2 cut(s) 150, 321
CviKI_1 RGCY 2 cut(s) 150, 321
DdeI CTNAG 2 cut(s) 138, 390
Eam1104I CTCTTC 1 cut(s) 181
EarI CTCTTC 1 cut(s) 181
Eco130I CCWWGG 2 cut(s) 106, 323
Eco47I GGWCC 1 cut(s) 228
EcoRII CCWGG 1 cut(s) 68
EcoT14I CCWWGG 2 cut(s) 106, 323
ErhI CCWWGG 2 cut(s) 106, 323
FaiI YATR 4 cut(s) 99, 130, 132, 333
FaqI GGGAC 1 cut(s) 341
FauNDI CATATG 1 cut(s) 130
FokI GGATG 2 cut(s) 17, 268
FspBI CTAG 1 cut(s) 197
HincII GTYRAC 2 cut(s) 61, 238
HindII GTYRAC 2 cut(s) 61, 238
HinfI GANTC 1 cut(s) 299
HpaI GTTAAC 1 cut(s) 238
Hpy166II GTNNAC 4 cut(s) 37, 61, 238, 313
Hpy188I TCNGA 1 cut(s) 391
Hpy188III TCNNGA 1 cut(s) 231
Hpy8I GTNNAC 4 cut(s) 37, 61, 238, 313
HpyAV CCTTC 1 cut(s) 170
HpyCH4III ACNGT 2 cut(s) 204, 317
HpyCH4IV ACGT 1 cut(s) 307
HpyCH4V TGCA 3 cut(s) 8, 77, 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 2 cut(s) 138, 390
HpySE526I ACGT 1 cut(s) 307
KspAI GTTAAC 1 cut(s) 238
LmnI GCTCC 1 cut(s) 139
LpnPI CCDG 9 cut(s) 25, 55, 82, 104, 158, 166, 231, 244, 299
LweI GCATC 1 cut(s) 262
MaeI CTAG 1 cut(s) 197
MaeII ACGT 1 cut(s) 307
MboII GAAGA 2 cut(s) 23, 198
MluCI AATT 1 cut(s) 23
MnlI CCTC 4 cut(s) 75, 147, 253, 378
MseI TTAA 3 cut(s) 237, 254, 360
MspR9I CCNGG 1 cut(s) 70
MvaI CCWGG 1 cut(s) 70
MwoI GCNNNNNNNGC 1 cut(s) 74
NdeI CATATG 1 cut(s) 130
NlaIV GGNNCC 1 cut(s) 229
PfeI GAWTC 1 cut(s) 299
Psp6I CCWGG 1 cut(s) 68
PspGI CCWGG 1 cut(s) 68
PspN4I GGNNCC 1 cut(s) 229
PspPI GGNCC 1 cut(s) 228
SaqAI TTAA 3 cut(s) 237, 254, 360
Sau96I GGNCC 1 cut(s) 228
ScrFI CCNGG 1 cut(s) 70
SetI ASST 4 cut(s) 74, 250, 264, 310
SfaNI GCATC 1 cut(s) 262
SfcI CTRYAG 1 cut(s) 316
SinI GGWCC 1 cut(s) 228
Sse9I AATT 1 cut(s) 23
SspMI CTAG 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 68
StyI CCWWGG 2 cut(s) 106, 323
TaaI ACNGT 2 cut(s) 204, 317
TaiI ACGT 1 cut(s) 310
TaqI TCGA 2 cut(s) 115, 270
TasI AATT 1 cut(s) 23
TfiI GAWTC 1 cut(s) 299
Tru1I TTAA 3 cut(s) 237, 254, 360
Tru9I TTAA 3 cut(s) 237, 254, 360
TscAI CASTG 1 cut(s) 34
TspDTI ATGAA 1 cut(s) 117
TspRI CASTG 1 cut(s) 34
VpaK11BI GGWCC 1 cut(s) 228
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.