Rmu_sc0001760.1_g000004

RNA-binding protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001760.1
Physical Location & Seq
Reverse (-)
16783 .. 18322
1540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001760.1_g000004.1.cds

Sequence Viewer

Length: 693 bp
atgcctcgatacaaagatgaacctcctgctgttcgtgtttacacagtctgtgacgaatcaaggtatttgatagtgaggaatgttccatctttgggatgcggtgatgagctgttgacgctgttctcctcctatggagatgtagaggagtgtaaaccaatggatgcagaagattgtgagcaattcactgatgtttactggataaagtttcgtcttgtcagcaacgccaggtttgcaaagaggaagttagacgagtatgttttccttggaaatcgactgggggtttcttatgctcctcagtttgagagccttgccgacacaaaggacaaactggaaggcaggagaagagaaattctagcacggttgaacccttgtggttctaaagggtccagagttaacaagtcaggtgctttaaccgaggtttcgttcgatgcaaccccatcccagacttacagcgattcccaacgtgtaaactgtagcccaagggactatggacaatcacaacatacttcgcaagttaataatcctcccgttacaagagtttcctctgagaaggaatattttgcttccgcatccatgaatcaaactgtccagatggtcagggaaaagctcgataagattcaatcaagtaccgagcatctactagaagggcataaatccaagaaagcaagggtggacaatagaaggagaatctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

230

Amino Acids

26.24

Weight (kDa)

8.67

Isoelectric Point (pI)

48.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 99, 567
AcsI RAATTY 1 cut(s) 348
AfaI GTAC 1 cut(s) 628
AfiI CCNNNNNNNGG 1 cut(s) 92
AflIII ACRYGT 1 cut(s) 463
AgsI TTSAA 2 cut(s) 364, 620
AjnI CCWGG 1 cut(s) 224
AluBI AGCT 2 cut(s) 109, 607
AluI AGCT 2 cut(s) 109, 607
ApoI RAATTY 1 cut(s) 348
AspS9I GGNCC 1 cut(s) 384
AsuHPI GGTGA 1 cut(s) 113
AvaII GGWCC 1 cut(s) 384
BccI CCATC 3 cut(s) 94, 445, 586
BciT130I CCWGG 1 cut(s) 226
BfaI CTAG 2 cut(s) 353, 641
BfmI CTRYAG 1 cut(s) 472
Bme1390I CCNGG 1 cut(s) 226
Bme18I GGWCC 1 cut(s) 384
BmgT120I GGNCC 1 cut(s) 384
BmiI GGNNCC 1 cut(s) 385
BmrFI CCNGG 1 cut(s) 226
BmrI ACTGGG 1 cut(s) 284
BmsI GCATC 5 cut(s) 86, 151, 418, 578, 643
BmuI ACTGGG 1 cut(s) 284
BsaJI CCNNGG 3 cut(s) 262, 414, 479
Bsc4I CCNNNNNNNGG 1 cut(s) 92
Bse1I ACTGG 3 cut(s) 200, 279, 333
BseBI CCWGG 1 cut(s) 226
BseDI CCNNGG 3 cut(s) 262, 414, 479
BseGI GGATG 4 cut(s) 101, 166, 437, 569
BseLI CCNNNNNNNGG 1 cut(s) 92
BseMII CTCAG 2 cut(s) 308, 537
BseNI ACTGG 3 cut(s) 200, 279, 333
BseRI GAGGAG 3 cut(s) 115, 158, 282
BslFI GGGAC 1 cut(s) 497
BslI CCNNNNNNNGG 1 cut(s) 92
BsmFI GGGAC 1 cut(s) 497
BspACI CCGC 2 cut(s) 99, 567
BspCNI CTCAG 2 cut(s) 307, 538
BspLI GGNNCC 1 cut(s) 385
BsrI ACTGG 3 cut(s) 200, 279, 333
BssECI CCNNGG 3 cut(s) 262, 414, 479
BssT1I CCWWGG 2 cut(s) 262, 479
Bst2UI CCWGG 1 cut(s) 226
Bst4CI ACNGT 4 cut(s) 46, 360, 473, 586
Bst6I CTCTTC 1 cut(s) 337
BstDEI CTNAG 2 cut(s) 294, 546
BstF5I GGATG 4 cut(s) 101, 166, 437, 569
BstMWI GCNNNNNNNGC 2 cut(s) 115, 230
BstNI CCWGG 1 cut(s) 226
BstSCI CCNGG 1 cut(s) 224
BstSFI CTRYAG 1 cut(s) 472
BtsCI GGATG 4 cut(s) 101, 166, 437, 569
BtsIMutI CAGTG 1 cut(s) 183
Cfr13I GGNCC 1 cut(s) 384
CseI GACGC 1 cut(s) 124
Csp6I GTAC 1 cut(s) 627
CviAII CATG 1 cut(s) 574
CviJI RGCY 4 cut(s) 109, 306, 477, 607
CviKI_1 RGCY 4 cut(s) 109, 306, 477, 607
CviQI GTAC 1 cut(s) 627
DdeI CTNAG 2 cut(s) 294, 546
Eam1104I CTCTTC 1 cut(s) 337
EarI CTCTTC 1 cut(s) 337
Eco130I CCWWGG 2 cut(s) 262, 479
Eco47I GGWCC 1 cut(s) 384
EcoRII CCWGG 1 cut(s) 224
EcoT14I CCWWGG 2 cut(s) 262, 479
ErhI CCWWGG 2 cut(s) 262, 479
FaeI CATG 1 cut(s) 577
FaiI YATR 7 cut(s) 132, 255, 288, 489, 504, 575, 651
FaqI GGGAC 1 cut(s) 497
FatI CATG 1 cut(s) 573
FokI GGATG 4 cut(s) 108, 173, 424, 556
FspBI CTAG 2 cut(s) 353, 641
HgaI GACGC 1 cut(s) 124
Hin1II CATG 1 cut(s) 577
HincII GTYRAC 2 cut(s) 114, 394
HindII GTYRAC 2 cut(s) 114, 394
HinfI GANTC 5 cut(s) 56, 455, 577, 616, 687
HpaI GTTAAC 1 cut(s) 394
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 7 cut(s) 40, 114, 152, 193, 394, 469, 673
Hpy188I TCNGA 1 cut(s) 547
Hpy188III TCNNGA 2 cut(s) 387, 589
Hpy8I GTNNAC 7 cut(s) 40, 114, 152, 193, 394, 469, 673
HpyAV CCTTC 4 cut(s) 326, 544, 638, 675
HpyCH4III ACNGT 4 cut(s) 46, 360, 473, 586
HpyCH4IV ACGT 1 cut(s) 463
HpyCH4V TGCA 3 cut(s) 164, 233, 431
HpyF10VI GCNNNNNNNGC 2 cut(s) 115, 230
HpyF3I CTNAG 2 cut(s) 294, 546
HpySE526I ACGT 1 cut(s) 463
Hsp92II CATG 1 cut(s) 577
KspAI GTTAAC 1 cut(s) 394
LmnI GCTCC 1 cut(s) 295
LweI GCATC 5 cut(s) 86, 151, 418, 578, 643
MaeI CTAG 2 cut(s) 353, 641
MaeII ACGT 1 cut(s) 463
MaeIII GTNAC 2 cut(s) 50, 529
MboII GAAGA 2 cut(s) 179, 354
MluCI AATT 2 cut(s) 179, 348
MseI TTAA 3 cut(s) 393, 410, 516
MspR9I CCNGG 1 cut(s) 226
MvaI CCWGG 1 cut(s) 226
MwoI GCNNNNNNNGC 2 cut(s) 115, 230
NlaIII CATG 1 cut(s) 577
NlaIV GGNNCC 1 cut(s) 385
NmuCI GTSAC 1 cut(s) 50
PfeI GAWTC 5 cut(s) 56, 455, 577, 616, 687
Psp6I CCWGG 1 cut(s) 224
PspGI CCWGG 1 cut(s) 224
PspN4I GGNNCC 1 cut(s) 385
PspPI GGNCC 1 cut(s) 384
RsaI GTAC 1 cut(s) 628
RsaNI GTAC 1 cut(s) 627
SaqAI TTAA 3 cut(s) 393, 410, 516
Sau96I GGNCC 1 cut(s) 384
ScrFI CCNGG 1 cut(s) 226
SetI ASST 8 cut(s) 25, 65, 111, 230, 406, 420, 466, 609
SfaNI GCATC 5 cut(s) 86, 151, 418, 578, 643
SfcI CTRYAG 1 cut(s) 472
SinI GGWCC 1 cut(s) 384
Sse9I AATT 2 cut(s) 179, 348
SsiI CCGC 2 cut(s) 99, 567
SspI AATATT 1 cut(s) 557
SspMI CTAG 2 cut(s) 353, 641
StyD4I CCNGG 1 cut(s) 224
StyI CCWWGG 2 cut(s) 262, 479
TaaI ACNGT 4 cut(s) 46, 360, 473, 586
TaiI ACGT 1 cut(s) 466
TaqI TCGA 4 cut(s) 7, 271, 426, 609
TasI AATT 2 cut(s) 179, 348
TfiI GAWTC 5 cut(s) 56, 455, 577, 616, 687
Tru1I TTAA 3 cut(s) 393, 410, 516
Tru9I TTAA 3 cut(s) 393, 410, 516
TscAI CASTG 1 cut(s) 190
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
TspDTI ATGAA 2 cut(s) 33, 590
TspRI CASTG 1 cut(s) 190
VpaK11BI GGWCC 1 cut(s) 384
XapI RAATTY 1 cut(s) 348
XspI CTAG 2 cut(s) 353, 641
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.