Rmu_co8012550.1_g000001

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8012550.1
Physical Location & Seq
Forward (+)
1 .. 291
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8012550.1_g000001.1.cds

Sequence Viewer

Length: 291 bp
aagagacttggtcgccgagtatgcaatttggagcatgttcatggctggaacataaaaccagtgaagtttgagcttacaacttctaatggtcaccaggctgtatcagaatattacttggacaaccctggaaactgggtcaattaccatgtgggagactttgttgttgacaatcctcatgctttgatcaagatcaatttttcgatgacccagatcgattgtactcacaccaaaggcggtgtctgtgtagactctgtgttgatacgccctagtagtgtaggaaaagagcattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.83

Weight (kDa)

7.96

Isoelectric Point (pI)

22.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012773)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 246
AciI CCGC 1 cut(s) 234
AfaI GTAC 1 cut(s) 220
AjnI CCWGG 2 cut(s) 93, 124
AluBI AGCT 1 cut(s) 73
AluI AGCT 1 cut(s) 73
Alw26I GTCTC 1 cut(s) 147
ArsI GACNNNNNNTTYG 2 cut(s) 222, 254
AsuHPI GGTGA 1 cut(s) 83
BciT130I CCWGG 2 cut(s) 95, 126
BclI TGATCA 1 cut(s) 183
BcoDI GTCTC 1 cut(s) 147
BfaI CTAG 1 cut(s) 267
Bme1390I CCNGG 2 cut(s) 95, 126
BmrFI CCNGG 2 cut(s) 95, 126
BmrI ACTGGG 1 cut(s) 142
BmuI ACTGGG 1 cut(s) 142
Bsa29I ATCGAT 1 cut(s) 213
BsaBI GATNNNNATC 1 cut(s) 188
BsaJI CCNNGG 1 cut(s) 124
BsaXI ACNNNNNCTCC 2 cut(s) 144, 174
Bse1I ACTGG 2 cut(s) 59, 137
Bse8I GATNNNNATC 1 cut(s) 188
BseBI CCWGG 2 cut(s) 95, 126
BseCI ATCGAT 1 cut(s) 213
BseDI CCNNGG 1 cut(s) 124
BseJI GATNNNNATC 1 cut(s) 188
BseNI ACTGG 2 cut(s) 59, 137
BshVI ATCGAT 1 cut(s) 213
BsmAI GTCTC 1 cut(s) 147
Bsp143I GATC 3 cut(s) 183, 189, 210
BspACI CCGC 1 cut(s) 234
BspDI ATCGAT 1 cut(s) 213
BsrI ACTGG 2 cut(s) 59, 137
BssECI CCNNGG 1 cut(s) 124
BssMI GATC 3 cut(s) 183, 189, 210
Bst2UI CCWGG 2 cut(s) 95, 126
BstEII GGTNACC 1 cut(s) 89
BstKTI GATC 3 cut(s) 186, 192, 213
BstMAI GTCTC 1 cut(s) 147
BstMBI GATC 3 cut(s) 183, 189, 210
BstMWI GCNNNNNNNGC 1 cut(s) 21
BstNI CCWGG 2 cut(s) 95, 126
BstNSI RCATGY 1 cut(s) 38
BstPI GGTNACC 1 cut(s) 89
BstSCI CCNGG 2 cut(s) 93, 124
Bsu15I ATCGAT 1 cut(s) 213
BsuTUI ATCGAT 1 cut(s) 213
BtsIMutI CAGTG 1 cut(s) 66
ClaI ATCGAT 1 cut(s) 213
Csp6I GTAC 1 cut(s) 219
CviAII CATG 4 cut(s) 35, 41, 146, 176
CviJI RGCY 3 cut(s) 45, 73, 98
CviKI_1 RGCY 3 cut(s) 45, 73, 98
CviQI GTAC 1 cut(s) 219
DpnI GATC 3 cut(s) 185, 191, 212
DpnII GATC 3 cut(s) 183, 189, 210
Eco91I GGTNACC 1 cut(s) 89
EcoO65I GGTNACC 1 cut(s) 89
EcoRII CCWGG 2 cut(s) 93, 124
FaeI CATG 4 cut(s) 38, 44, 149, 179
FaiI YATR 6 cut(s) 22, 36, 42, 53, 147, 177
FatI CATG 4 cut(s) 34, 40, 145, 175
FbaI TGATCA 1 cut(s) 183
FblI GTMKAC 1 cut(s) 246
FspBI CTAG 1 cut(s) 267
Hin1II CATG 4 cut(s) 38, 44, 149, 179
HincII GTYRAC 1 cut(s) 166
HindII GTYRAC 1 cut(s) 166
HinfI GANTC 1 cut(s) 248
HphI GGTGA 1 cut(s) 83
Hpy166II GTNNAC 2 cut(s) 166, 247
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 1 cut(s) 187
Hpy8I GTNNAC 2 cut(s) 166, 247
HpyCH4V TGCA 1 cut(s) 24
HpyF10VI GCNNNNNNNGC 1 cut(s) 21
Hsp92II CATG 4 cut(s) 38, 44, 149, 179
Ksp22I TGATCA 1 cut(s) 183
Kzo9I GATC 3 cut(s) 183, 189, 210
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 8 cut(s) 31, 72, 80, 107, 111, 118, 138, 221
MaeI CTAG 1 cut(s) 267
MaeIII GTNAC 1 cut(s) 89
MalI GATC 3 cut(s) 185, 191, 212
MboI GATC 3 cut(s) 183, 189, 210
MluCI AATT 3 cut(s) 25, 139, 193
MlyI GAGTC 1 cut(s) 242
MnlI CCTC 1 cut(s) 183
MslI CAYNNNNRTG 1 cut(s) 39
MspR9I CCNGG 2 cut(s) 95, 126
MvaI CCWGG 2 cut(s) 95, 126
MwoI GCNNNNNNNGC 1 cut(s) 21
NdeII GATC 3 cut(s) 183, 189, 210
NlaIII CATG 4 cut(s) 38, 44, 149, 179
NmeAIII GCCGAG 1 cut(s) 41
NmuCI GTSAC 1 cut(s) 89
NspI RCATGY 1 cut(s) 38
PflFI GACNNNGTC 1 cut(s) 9
PleI GAGTC 1 cut(s) 242
PpsI GAGTC 1 cut(s) 242
Psp6I CCWGG 2 cut(s) 93, 124
PspEI GGTNACC 1 cut(s) 89
PspGI CCWGG 2 cut(s) 93, 124
PsyI GACNNNGTC 1 cut(s) 9
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
RseI CAYNNNNRTG 1 cut(s) 39
Sau3AI GATC 3 cut(s) 183, 189, 210
SchI GAGTC 1 cut(s) 242
ScrFI CCNGG 2 cut(s) 95, 126
SetI ASST 1 cut(s) 75
SmiMI CAYNNNNRTG 1 cut(s) 39
Sse9I AATT 3 cut(s) 25, 139, 193
SsiI CCGC 1 cut(s) 234
SspI AATATT 1 cut(s) 110
SspMI CTAG 1 cut(s) 267
StyD4I CCNGG 2 cut(s) 93, 124
TaqI TCGA 2 cut(s) 200, 213
TasI AATT 3 cut(s) 25, 139, 193
TatI WGTACW 1 cut(s) 218
TscAI CASTG 1 cut(s) 66
TseFI GTSAC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 29
TspRI CASTG 1 cut(s) 66
Tth111I GACNNNGTC 1 cut(s) 9
XceI RCATGY 1 cut(s) 38
XmiI GTMKAC 1 cut(s) 246
XspI CTAG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.