Rorug01G0228000

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
32862198 .. 32866841
4644 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0228000.1

Sequence Viewer

Length: 441 bp
ATGGCCTTTGTCCTAGACAAAGGGAGTTCTTCATTGGCTTCACAAAGGGCCAGTTGCAGCTCTGTTGATCTCCAAAAGCCAGCTGAACTGGATGGGAAGGCATGTGCAGCTATTGGACAGCCTGATCTGATGGCTCTCTTGAAGTCCGTGTTTAGTGAGGATGTGACACAAGCTCAGTGTCTTGTCACAGAAAGTGACTTTAGGGGTAAAGATTTTCAAAGGCAGCTGAAAGAAACGGTCGATCACTTGCTGTCTTTAAAGACTATACCTATATTCAATGAAAATGATGCAGTTAGTACCAGAACAGATTTATGTGAGGATTCTTCTGGTATATTTTGGGACAATGACAGTTTGGCAGCTATACTAGCTAAGGAGCTAAAGGCTGATCTTCTTATCCTTATCAGTGATGTGGAGGGTCTCTACAGTGGGCCTCCCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

15.78

Weight (kDa)

4.48

Isoelectric Point (pI)

31.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AA_kinase PF00696 33 - 146 8.6e-18 Amino acid kinase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012773)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 298
AgsI TTSAA 3 cut(s) 142, 218, 277
AluBI AGCT 8 cut(s) 60, 83, 110, 173, 226, 359, 368, 376
AluI AGCT 8 cut(s) 60, 83, 110, 173, 226, 359, 368, 376
Alw26I GTCTC 1 cut(s) 422
AoxI GGCC 3 cut(s) 3, 48, 428
ApeKI GCWGC 4 cut(s) 57, 107, 223, 356
AspS9I GGNCC 2 cut(s) 48, 428
BbvI GCAGC 4 cut(s) 69, 119, 235, 368
BccI CCATC 2 cut(s) 86, 124
BcoDI GTCTC 1 cut(s) 422
BfaI CTAG 2 cut(s) 14, 365
BfmI CTRYAG 1 cut(s) 421
BisI GCNGC 4 cut(s) 58, 108, 224, 357
BlsI GCNGC 4 cut(s) 59, 109, 225, 358
BmgT120I GGNCC 2 cut(s) 48, 428
BmsI GCATC 1 cut(s) 277
Bpu10I CCTNAGC 1 cut(s) 369
BsaI GGTCTC 1 cut(s) 422
Bse1I ACTGG 2 cut(s) 51, 93
BseGI GGATG 2 cut(s) 97, 166
BseMII CTCAG 1 cut(s) 188
BseNI ACTGG 2 cut(s) 51, 93
BseXI GCAGC 4 cut(s) 69, 119, 235, 368
BsgI GTGCAG 1 cut(s) 126
Bsh1285I CGRYCG 1 cut(s) 240
BshFI GGCC 3 cut(s) 5, 50, 430
BsiEI CGRYCG 1 cut(s) 240
BslFI GGGAC 1 cut(s) 353
BsmAI GTCTC 1 cut(s) 422
BsmFI GGGAC 1 cut(s) 353
BsnI GGCC 3 cut(s) 5, 50, 430
Bso31I GGTCTC 1 cut(s) 422
Bsp143I GATC 4 cut(s) 67, 124, 241, 385
BspANI GGCC 3 cut(s) 5, 50, 430
BspCNI CTCAG 1 cut(s) 187
BspTNI GGTCTC 1 cut(s) 422
BsrI ACTGG 2 cut(s) 51, 93
BssMI GATC 4 cut(s) 67, 124, 241, 385
Bst4CI ACNGT 3 cut(s) 238, 350, 425
BstC8I GCNNGC 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 174, 369
BstF5I GGATG 2 cut(s) 97, 166
BstKTI GATC 4 cut(s) 70, 127, 244, 388
BstMAI GTCTC 1 cut(s) 422
BstMBI GATC 4 cut(s) 67, 124, 241, 385
BstMCI CGRYCG 1 cut(s) 240
BstMWI GCNNNNNNNGC 2 cut(s) 107, 365
BstNSI RCATGY 1 cut(s) 105
BstSFI CTRYAG 1 cut(s) 421
BstV1I GCAGC 4 cut(s) 69, 119, 235, 368
BsuRI GGCC 3 cut(s) 5, 50, 430
BtsCI GGATG 2 cut(s) 97, 166
BtsIMutI CAGTG 3 cut(s) 182, 409, 430
Cac8I GCNNGC 1 cut(s) 81
Cfr13I GGNCC 2 cut(s) 48, 428
Csp6I GTAC 1 cut(s) 297
CviAII CATG 1 cut(s) 102
CviQI GTAC 1 cut(s) 297
DdeI CTNAG 2 cut(s) 174, 369
DpnI GATC 4 cut(s) 69, 126, 243, 387
DpnII GATC 4 cut(s) 67, 124, 241, 385
DraI TTTAAA 1 cut(s) 258
Eco31I GGTCTC 1 cut(s) 422
FaeI CATG 1 cut(s) 105
FaiI YATR 6 cut(s) 103, 266, 272, 313, 332, 362
FaqI GGGAC 1 cut(s) 353
FatI CATG 1 cut(s) 101
Fnu4HI GCNGC 4 cut(s) 58, 108, 224, 357
FokI GGATG 2 cut(s) 104, 173
Fsp4HI GCNGC 4 cut(s) 58, 108, 224, 357
FspBI CTAG 2 cut(s) 14, 365
GluI GCNGC 4 cut(s) 58, 108, 224, 357
HaeIII GGCC 3 cut(s) 5, 50, 430
Hin1II CATG 1 cut(s) 105
HinfI GANTC 1 cut(s) 320
Hpy188I TCNGA 1 cut(s) 129
Hpy188III TCNNGA 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 91
HpyCH4III ACNGT 3 cut(s) 238, 350, 425
HpyCH4V TGCA 3 cut(s) 57, 107, 290
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 365
HpyF3I CTNAG 2 cut(s) 174, 369
Hsp92II CATG 1 cut(s) 105
Kzo9I GATC 4 cut(s) 67, 124, 241, 385
LmnI GCTCC 1 cut(s) 373
LpnPI CCDG 6 cut(s) 64, 74, 93, 135, 312, 313
Lsp1109I GCAGC 4 cut(s) 69, 119, 235, 368
LweI GCATC 1 cut(s) 277
MaeI CTAG 2 cut(s) 14, 365
MaeIII GTNAC 3 cut(s) 163, 184, 194
MalI GATC 4 cut(s) 69, 126, 243, 387
MboI GATC 4 cut(s) 67, 124, 241, 385
MboII GAAGA 3 cut(s) 21, 315, 380
MnlI CCTC 4 cut(s) 151, 310, 406, 441
MseI TTAA 1 cut(s) 257
MspA1I CMGCKG 2 cut(s) 83, 226
MwoI GCNNNNNNNGC 2 cut(s) 107, 365
NdeII GATC 4 cut(s) 67, 124, 241, 385
NlaIII CATG 1 cut(s) 105
NmuCI GTSAC 3 cut(s) 163, 184, 194
NspI RCATGY 1 cut(s) 105
PfeI GAWTC 1 cut(s) 320
PkrI GCNGC 4 cut(s) 59, 109, 225, 358
PspPI GGNCC 2 cut(s) 48, 428
PvuII CAGCTG 2 cut(s) 83, 226
RsaI GTAC 1 cut(s) 298
RsaNI GTAC 1 cut(s) 297
SaqAI TTAA 1 cut(s) 257
SatI GCNGC 4 cut(s) 58, 108, 224, 357
Sau3AI GATC 4 cut(s) 67, 124, 241, 385
Sau96I GGNCC 2 cut(s) 48, 428
SetI ASST 9 cut(s) 62, 85, 112, 175, 228, 271, 361, 370, 378
SfaNI GCATC 1 cut(s) 277
SfcI CTRYAG 1 cut(s) 421
SspMI CTAG 2 cut(s) 14, 365
TaaI ACNGT 3 cut(s) 238, 350, 425
TaqI TCGA 1 cut(s) 240
TfiI GAWTC 1 cut(s) 320
Tru1I TTAA 1 cut(s) 257
Tru9I TTAA 1 cut(s) 257
TscAI CASTG 3 cut(s) 182, 409, 430
TseFI GTSAC 3 cut(s) 163, 184, 194
TseI GCWGC 4 cut(s) 57, 107, 223, 356
Tsp45I GTSAC 3 cut(s) 163, 184, 194
TspDTI ATGAA 2 cut(s) 21, 294
TspGWI ACGGA 1 cut(s) 136
TspRI CASTG 3 cut(s) 182, 409, 430
XceI RCATGY 1 cut(s) 105
XspI CTAG 2 cut(s) 14, 365
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.