Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8018042.1

Orthogroup ID

OG0009890

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 537

Gene Structure 537 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8018042.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

ggtggtggtggtggtggtggtaatgatgatggggaagacggagaagaagaagagtttgggccaattctgaaatttgaagaagttatgaaagagacagaggcacgaggagctagtcttccccttgatatgttagaggctgccaagaatgtgggaattcgcaaagttcttctacatagatatctggatttgcaggggtcagcctggcctcttggctttgcaatgaagtcatgctctatgcttcgagatcgtatgctagctgacccatcctttcttttcaaaattggaacagag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RETICULATA-like

Protein Analysis

97

Amino Acids

10.51

Weight (kDa)

4.67

Isoelectric Point (pI)

38.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009890)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G37860 AT2G37860 AT2G37860 AT2G37860
fragaria_vesca	FvH4_6g12860
malus_domestica	MD04G1137400.v1.1
prunus_persica	Prupe.6G263400_v2.0.a1 Prupe.6G263400_v2.0.a1
pyrus_communis	pycom04g12570
rosa_chinensis	RchiOBHm_Chr3g0464891
rosa_laevigata	RLG00000024667
rosa_multiflora	Rmu_co8018042.1_g000001 Rmu_sc0007114.1_g000002 Rmu_sc0021790.1_g000001 Rmu_sc0026665.1_g000001
rosa_roxburghii	Rroxscaffold_6G00415370
rosa_rugosa	Rorug03G0074500
rosa_samantha	Rh3BG137400 Rh3CG140000 Rh3DG138800
rosa_wichuraiana	Rw3G011230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	71, 153
AgsI	TTSAA	2 cut(s)	77, 277
AjnI	CCWGG	1 cut(s)	200
AjuI	GAANNNNNNNTTGG	2 cut(s)	39, 71
AluBI	AGCT	2 cut(s)	110, 257
AluI	AGCT	2 cut(s)	110, 257
Alw26I	GTCTC	1 cut(s)	86
AoxI	GGCC	2 cut(s)	59, 203
ApeKI	GCWGC	1 cut(s)	137
ApoI	RAATTY	2 cut(s)	71, 153
AspS9I	GGNCC	1 cut(s)	59
AsuNHI	GCTAGC	1 cut(s)	253
BauI	CACGAG	1 cut(s)	102
BbsI	GAAGAC	2 cut(s)	42, 107
BbvI	GCAGC	1 cut(s)	124
BccI	CCATC	2 cut(s)	23, 271
BciT130I	CCWGG	1 cut(s)	202
BcoDI	GTCTC	1 cut(s)	86
BfaI	CTAG	2 cut(s)	111, 254
BisI	GCNGC	1 cut(s)	138
BlsI	GCNGC	1 cut(s)	139
Bme1390I	CCNGG	1 cut(s)	202
BmgT120I	GGNCC	1 cut(s)	59
BmrFI	CCNGG	1 cut(s)	202
BmtI	GCTAGC	1 cut(s)	257
BpiI	GAAGAC	2 cut(s)	42, 107
Bse3DI	GCAATG	1 cut(s)	225
BseBI	CCWGG	1 cut(s)	202
BseGI	GGATG	1 cut(s)	263
BseMI	GCAATG	1 cut(s)	225
BseRI	GAGGAG	1 cut(s)	120
BseXI	GCAGC	1 cut(s)	124
BshFI	GGCC	2 cut(s)	61, 205
BsmAI	GTCTC	1 cut(s)	86
BsnI	GGCC	2 cut(s)	61, 205
Bsp143I	GATC	1 cut(s)	244
BspANI	GGCC	2 cut(s)	61, 205
BspOI	GCTAGC	1 cut(s)	257
BsrDI	GCAATG	1 cut(s)	225
BssMI	GATC	1 cut(s)	244
BssSI	CACGAG	1 cut(s)	102
Bst2BI	CACGAG	1 cut(s)	102
Bst2UI	CCWGG	1 cut(s)	202
Bst6I	CTCTTC	1 cut(s)	45
BstC8I	GCNNGC	1 cut(s)	255
BstF5I	GGATG	1 cut(s)	263
BstKTI	GATC	1 cut(s)	247
BstMAI	GTCTC	1 cut(s)	86
BstMBI	GATC	1 cut(s)	244
BstMWI	GCNNNNNNNGC	1 cut(s)	107
BstNI	CCWGG	1 cut(s)	202
BstSCI	CCNGG	1 cut(s)	200
BstV1I	GCAGC	1 cut(s)	124
BstV2I	GAAGAC	2 cut(s)	42, 107
BstXI	CCANNNNNNTGG	1 cut(s)	148
BsuRI	GGCC	2 cut(s)	61, 205
BtsCI	GGATG	1 cut(s)	263
Cac8I	GCNNGC	1 cut(s)	255
Cfr13I	GGNCC	1 cut(s)	59
CviAII	CATG	1 cut(s)	228
CviJI	RGCY	7 cut(s)	61, 110, 137, 200, 205, 213, 257
CviKI_1	RGCY	7 cut(s)	61, 110, 137, 200, 205, 213, 257
DpnI	GATC	1 cut(s)	246
DpnII	GATC	1 cut(s)	244
Eam1104I	CTCTTC	1 cut(s)	45
EarI	CTCTTC	1 cut(s)	45
Eco32I	GATATC	1 cut(s)	179
EcoRI	GAATTC	1 cut(s)	153
EcoRII	CCWGG	1 cut(s)	200
EcoRV	GATATC	1 cut(s)	179
FaeI	CATG	1 cut(s)	231
FaiI	YATR	6 cut(s)	86, 128, 174, 229, 236, 251
FatI	CATG	1 cut(s)	227
Fnu4HI	GCNGC	1 cut(s)	138
FokI	GGATG	1 cut(s)	250
Fsp4HI	GCNGC	1 cut(s)	138
FspBI	CTAG	2 cut(s)	111, 254
GluI	GCNGC	1 cut(s)	138
HaeIII	GGCC	2 cut(s)	61, 205
Hin1II	CATG	1 cut(s)	231
Hpy188I	TCNGA	1 cut(s)	69
Hpy188III	TCNNGA	2 cut(s)	182, 242
HpyCH4V	TGCA	2 cut(s)	190, 218
HpyF10VI	GCNNNNNNNGC	1 cut(s)	107
Hsp92II	CATG	1 cut(s)	231
Kzo9I	GATC	1 cut(s)	244
LmnI	GCTCC	1 cut(s)	107
LpnPI	CCDG	4 cut(s)	167, 176, 187, 214
Lsp1109I	GCAGC	1 cut(s)	124
MaeI	CTAG	2 cut(s)	111, 254
MalI	GATC	1 cut(s)	246
MboI	GATC	1 cut(s)	244
MboII	GAAGA	7 cut(s)	47, 56, 59, 62, 89, 107, 158
MluCI	AATT	4 cut(s)	63, 71, 153, 279
MnlI	CCTC	4 cut(s)	91, 98, 127, 216
MspR9I	CCNGG	1 cut(s)	202
MvaI	CCWGG	1 cut(s)	202
MwoI	GCNNNNNNNGC	1 cut(s)	107
NdeII	GATC	1 cut(s)	244
NheI	GCTAGC	1 cut(s)	253
NlaIII	CATG	1 cut(s)	231
PkrI	GCNGC	1 cut(s)	139
Psp6I	CCWGG	1 cut(s)	200
PspGI	CCWGG	1 cut(s)	200
PspPI	GGNCC	1 cut(s)	59
SatI	GCNGC	1 cut(s)	138
Sau3AI	GATC	1 cut(s)	244
Sau96I	GGNCC	1 cut(s)	59
ScrFI	CCNGG	1 cut(s)	202
SetI	ASST	2 cut(s)	112, 259
Sse9I	AATT	4 cut(s)	63, 71, 153, 279
SspMI	CTAG	2 cut(s)	111, 254
StyD4I	CCNGG	1 cut(s)	200
TaqI	TCGA	1 cut(s)	241
TasI	AATT	4 cut(s)	63, 71, 153, 279
TseI	GCWGC	1 cut(s)	137
TspDTI	ATGAA	2 cut(s)	101, 236
TspGWI	ACGGA	1 cut(s)	54
XapI	RAATTY	2 cut(s)	71, 153
XspI	CTAG	2 cut(s)	111, 254

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.