Rmu_sc0021790.1_g000001

Protein RETICULATA-related

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021790.1
Physical Location & Seq
Forward (+)
1 .. 611
611 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021790.1_g000001.1.cds

Sequence Viewer

Length: 194 bp
gtgttttccttgccgtgtcttcaaacacccgctatcagataatcaatggacttgaacgcttggtagagacatcgcctttggcaaagcagatcccgcctgtagcattggctttcactgttggtgtacgattcgccaacaatgtgtatggcggaatgcagttcgtagactgggctagatggagtggggtgcaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

6.98

Weight (kDa)

9.69

Isoelectric Point (pI)

24.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 164
AciI CCGC 3 cut(s) 30, 94, 149
AclWI GGATC 1 cut(s) 84
AfaI GTAC 1 cut(s) 125
AgsI TTSAA 2 cut(s) 23, 55
Alw26I GTCTC 1 cut(s) 61
AlwI GGATC 1 cut(s) 84
ArsI GACNNNNNNTTYG 2 cut(s) 60, 92
BbsI GAAGAC 1 cut(s) 11
BccI CCATC 1 cut(s) 170
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 1 cut(s) 173
BfmI CTRYAG 1 cut(s) 98
BmrI ACTGGG 1 cut(s) 177
BmuI ACTGGG 1 cut(s) 177
BpiI GAAGAC 1 cut(s) 11
Bse1I ACTGG 1 cut(s) 172
BseNI ACTGG 1 cut(s) 172
BsmAI GTCTC 1 cut(s) 61
BsmI GAATGC 1 cut(s) 158
Bsp143I GATC 1 cut(s) 89
BspACI CCGC 3 cut(s) 30, 94, 149
BspPI GGATC 1 cut(s) 84
BsrI ACTGG 1 cut(s) 172
BssMI GATC 1 cut(s) 89
Bst4CI ACNGT 1 cut(s) 117
BstKTI GATC 1 cut(s) 92
BstMAI GTCTC 1 cut(s) 61
BstMBI GATC 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 93
BstSFI CTRYAG 1 cut(s) 98
BstV2I GAAGAC 1 cut(s) 11
BstX2I RGATCY 1 cut(s) 89
BstYI RGATCY 1 cut(s) 89
BtgZI GCGATG 1 cut(s) 56
BtsIMutI CAGTG 1 cut(s) 113
Csp6I GTAC 1 cut(s) 124
CviJI RGCY 2 cut(s) 109, 172
CviKI_1 RGCY 2 cut(s) 109, 172
CviQI GTAC 1 cut(s) 124
DpnI GATC 1 cut(s) 91
DpnII GATC 1 cut(s) 89
EciI GGCGGA 1 cut(s) 164
FaiI YATR 1 cut(s) 146
FauI CCCGC 2 cut(s) 37, 101
FblI GTMKAC 1 cut(s) 164
FspBI CTAG 1 cut(s) 173
HinfI GANTC 1 cut(s) 128
Hpy166II GTNNAC 2 cut(s) 124, 165
Hpy188I TCNGA 1 cut(s) 38
Hpy8I GTNNAC 2 cut(s) 124, 165
HpyCH4III ACNGT 1 cut(s) 117
HpyCH4V TGCA 2 cut(s) 156, 189
HpyF10VI GCNNNNNNNGC 1 cut(s) 93
Kzo9I GATC 1 cut(s) 89
LpnPI CCDG 2 cut(s) 110, 153
MaeI CTAG 1 cut(s) 173
MalI GATC 1 cut(s) 91
MboI GATC 1 cut(s) 89
MboII GAAGA 1 cut(s) 11
MflI RGATCY 1 cut(s) 89
Mva1269I GAATGC 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 93
NdeII GATC 1 cut(s) 89
PctI GAATGC 1 cut(s) 158
PfeI GAWTC 1 cut(s) 128
PsuI RGATCY 1 cut(s) 89
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
Sau3AI GATC 1 cut(s) 89
SfcI CTRYAG 1 cut(s) 98
SgeI CNNG 9 cut(s) 22, 27, 41, 64, 72, 105, 109, 180, 185
SsiI CCGC 3 cut(s) 30, 94, 149
SspMI CTAG 1 cut(s) 173
TaaI ACNGT 1 cut(s) 117
TfiI GAWTC 1 cut(s) 128
TscAI CASTG 1 cut(s) 120
TspRI CASTG 1 cut(s) 120
XmiI GTMKAC 1 cut(s) 164
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.