Rmu_co8048980.1_g000001

Cell division control protein 24, OB domain 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8048980.1
OG0017434
Physical Location & Seq
Reverse (-)
1 .. 423
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8048980.1_g000001.1.cds

Sequence Viewer

Length: 276 bp
atgacggcggaccaccagcgtctggttccttttctcgtcagggttactatgaacttggtggaaatgaactcagtcgacttgccagactgcaatccgcagccacaagaagaagaccccctccttaaattcattgattatgccaggtccgctctcttgcttgaaacagacgaagattcggatccgaaaggaaatggggcggagaccgcccgacctagttggaattggatctcctctcggattctcaagacctgtagcgcctactccaacggcgttacg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CDC24_OB1 CDC24_OB2 CDC24_OB3

Protein Analysis

92

Amino Acids

10.32

Weight (kDa)

4.5

Isoelectric Point (pI)

38.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 22
AccBSI CCGCTC 1 cut(s) 149
AccI GTMKAC 1 cut(s) 75
AciI CCGC 5 cut(s) 8, 95, 147, 197, 204
AclWI GGATC 3 cut(s) 173, 186, 233
AcsI RAATTY 1 cut(s) 125
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 1 cut(s) 161
AjnI CCWGG 1 cut(s) 140
Alw26I GTCTC 1 cut(s) 194
AlwI GGATC 3 cut(s) 173, 186, 233
AlwNI CAGNNNCTG 1 cut(s) 22
ApeKI GCWGC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 125
AspLEI GCGC 1 cut(s) 257
AspS9I GGNCC 2 cut(s) 10, 144
AvaII GGWCC 2 cut(s) 10, 144
BamHI GGATCC 1 cut(s) 178
BbsI GAAGAC 1 cut(s) 117
BbvI GCAGC 1 cut(s) 109
BceAI ACGGC 1 cut(s) 21
BciT130I CCWGG 1 cut(s) 142
BcoDI GTCTC 1 cut(s) 194
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 250
BfoI RGCGCY 1 cut(s) 258
BisI GCNGC 1 cut(s) 98
BlsI GCNGC 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 142
Bme18I GGWCC 2 cut(s) 10, 144
BmgT120I GGNCC 2 cut(s) 10, 144
BmiI GGNNCC 2 cut(s) 27, 180
BmrFI CCNGG 1 cut(s) 142
BpiI GAAGAC 1 cut(s) 117
BpuEI CTTGAG 1 cut(s) 227
BsaBI GATNNNNATC 1 cut(s) 177
BsaI GGTCTC 1 cut(s) 194
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse8I GATNNNNATC 1 cut(s) 177
BseBI CCWGG 1 cut(s) 142
BseJI GATNNNNATC 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 84
BseRI GAGGAG 1 cut(s) 220
BseXI GCAGC 1 cut(s) 109
BslI CCNNNNNNNGG 1 cut(s) 22
BsmAI GTCTC 1 cut(s) 194
Bso31I GGTCTC 1 cut(s) 194
Bsp143I GATC 2 cut(s) 178, 225
BspACI CCGC 5 cut(s) 8, 95, 147, 197, 204
BspCNI CTCAG 1 cut(s) 83
BspLI GGNNCC 2 cut(s) 27, 180
BspPI GGATC 3 cut(s) 173, 186, 233
BspTNI GGTCTC 1 cut(s) 194
BsrBI CCGCTC 1 cut(s) 149
BssMI GATC 2 cut(s) 178, 225
Bst2UI CCWGG 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 70
BstH2I RGCGCY 1 cut(s) 258
BstHHI GCGC 1 cut(s) 257
BstKTI GATC 2 cut(s) 181, 228
BstMAI GTCTC 1 cut(s) 194
BstMBI GATC 2 cut(s) 178, 225
BstMWI GCNNNNNNNGC 2 cut(s) 146, 203
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstSFI CTRYAG 1 cut(s) 250
BstV1I GCAGC 1 cut(s) 109
BstV2I GAAGAC 1 cut(s) 117
BstX2I RGATCY 2 cut(s) 178, 225
BstYI RGATCY 2 cut(s) 178, 225
CaiI CAGNNNCTG 1 cut(s) 22
CfoI GCGC 1 cut(s) 257
Cfr13I GGNCC 2 cut(s) 10, 144
CseI GACGC 1 cut(s) 8
CviJI RGCY 1 cut(s) 100
CviKI_1 RGCY 1 cut(s) 100
DdeI CTNAG 1 cut(s) 70
DpnI GATC 2 cut(s) 180, 227
DpnII GATC 2 cut(s) 178, 225
EciI GGCGGA 2 cut(s) 23, 212
Eco31I GGTCTC 1 cut(s) 194
Eco47I GGWCC 2 cut(s) 10, 144
EcoRII CCWGG 1 cut(s) 140
FaiI YATR 2 cut(s) 50, 138
FblI GTMKAC 1 cut(s) 75
Fnu4HI GCNGC 1 cut(s) 98
Fsp4HI GCNGC 1 cut(s) 98
FspBI CTAG 1 cut(s) 213
GlaI GCGC 1 cut(s) 256
GluI GCNGC 1 cut(s) 98
HaeII RGCGCY 1 cut(s) 258
HgaI GACGC 1 cut(s) 8
HhaI GCGC 1 cut(s) 257
Hin6I GCGC 1 cut(s) 255
HinP1I GCGC 1 cut(s) 255
HincII GTYRAC 1 cut(s) 76
HindII GTYRAC 1 cut(s) 76
HinfI GANTC 2 cut(s) 173, 238
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 3 cut(s) 178, 183, 237
Hpy188III TCNNGA 1 cut(s) 244
Hpy8I GTNNAC 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 90
HpyF10VI GCNNNNNNNGC 2 cut(s) 146, 203
HpyF3I CTNAG 1 cut(s) 70
HspAI GCGC 1 cut(s) 255
Kzo9I GATC 2 cut(s) 178, 225
LpnPI CCDG 7 cut(s) 8, 25, 29, 96, 127, 154, 262
Lsp1109I GCAGC 1 cut(s) 109
MaeI CTAG 1 cut(s) 213
MaeIII GTNAC 2 cut(s) 43, 271
MalI GATC 2 cut(s) 180, 227
MbiI CCGCTC 1 cut(s) 149
MboI GATC 2 cut(s) 178, 225
MboII GAAGA 3 cut(s) 119, 122, 182
MflI RGATCY 2 cut(s) 178, 225
MluCI AATT 2 cut(s) 125, 220
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 2 cut(s) 128, 241
MseI TTAA 1 cut(s) 123
MspR9I CCNGG 1 cut(s) 142
MvaI CCWGG 1 cut(s) 142
MwoI GCNNNNNNNGC 2 cut(s) 146, 203
NdeII GATC 2 cut(s) 178, 225
NlaIV GGNNCC 2 cut(s) 27, 180
PfeI GAWTC 2 cut(s) 173, 238
PflMI CCANNNNNTGG 1 cut(s) 22
PkrI GCNGC 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 140
PspGI CCWGG 1 cut(s) 140
PspN4I GGNNCC 2 cut(s) 27, 180
PspPI GGNCC 2 cut(s) 10, 144
PstNI CAGNNNCTG 1 cut(s) 22
PsuI RGATCY 2 cut(s) 178, 225
SalI GTCGAC 1 cut(s) 74
SaqAI TTAA 1 cut(s) 123
SatI GCNGC 1 cut(s) 98
Sau3AI GATC 2 cut(s) 178, 225
Sau96I GGNCC 2 cut(s) 10, 144
ScrFI CCNGG 1 cut(s) 142
SetI ASST 3 cut(s) 146, 214, 251
SfcI CTRYAG 1 cut(s) 250
SinI GGWCC 2 cut(s) 10, 144
SmlI CTYRAG 1 cut(s) 242
SmoI CTYRAG 1 cut(s) 242
Sse9I AATT 2 cut(s) 125, 220
SsiI CCGC 5 cut(s) 8, 95, 147, 197, 204
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 1 cut(s) 140
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 125, 220
TfiI GAWTC 2 cut(s) 173, 238
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TseI GCWGC 1 cut(s) 97
TspDTI ATGAA 3 cut(s) 65, 80, 118
Van91I CCANNNNNTGG 1 cut(s) 22
VpaK11BI GGWCC 2 cut(s) 10, 144
XapI RAATTY 1 cut(s) 125
XmiI GTMKAC 1 cut(s) 75
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.