Rmu_sc0005082.1_g000001

Cell division control protein 24, OB domain 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005082.1
OG0017434
Physical Location & Seq
Forward (+)
1109 .. 1420
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005082.1_g000001.1.cds

Sequence Viewer

Length: 312 bp
atgacggcggaccacctgcgtctagttctttttctcgtcagggttactgtgaacttggtggaaatgaacttagtcgatttgccggactggaatctgcagccacaagaagaagaccccctcctcaaattcatcaattacgccaggtttgctctcttgcctgaaaccaacgaagattcagatcagaacagaaatggggcagagaccgcccgacccagctggaattggatcgcctctcggattctcaagacctgcagcgcctactcaagcggcgttacgacgacgattttgctctatgatctctcacaggtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CDC24_OB1 CDC24_OB2 CDC24_OB3

Protein Analysis

103

Amino Acids

11.78

Weight (kDa)

4.61

Isoelectric Point (pI)

43.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 24
Acc36I ACCTGC 2 cut(s) 24, 257
AciI CCGC 3 cut(s) 8, 204, 267
AclWI GGATC 1 cut(s) 233
AcsI RAATTY 1 cut(s) 125
AjnI CCWGG 1 cut(s) 140
AluBI AGCT 1 cut(s) 216
AluI AGCT 1 cut(s) 216
Alw26I GTCTC 1 cut(s) 194
AlwI GGATC 1 cut(s) 233
ApeKI GCWGC 2 cut(s) 97, 252
ApoI RAATTY 1 cut(s) 125
ArsI GACNNNNNNTTYG 2 cut(s) 268, 300
AspLEI GCGC 1 cut(s) 257
AspS9I GGNCC 1 cut(s) 10
AvaII GGWCC 1 cut(s) 10
BbsI GAAGAC 1 cut(s) 117
BbvI GCAGC 2 cut(s) 109, 264
BceAI ACGGC 1 cut(s) 21
BcgI CGANNNNNNTGC 2 cut(s) 268, 302
BciT130I CCWGG 1 cut(s) 142
BcoDI GTCTC 1 cut(s) 194
BfaI CTAG 1 cut(s) 23
BfmI CTRYAG 2 cut(s) 95, 250
BfoI RGCGCY 1 cut(s) 258
BfuAI ACCTGC 2 cut(s) 24, 257
BisI GCNGC 3 cut(s) 98, 253, 268
BlsI GCNGC 3 cut(s) 99, 254, 269
Bme1390I CCNGG 1 cut(s) 142
Bme18I GGWCC 1 cut(s) 10
BmgT120I GGNCC 1 cut(s) 10
BmrFI CCNGG 1 cut(s) 142
BpiI GAAGAC 1 cut(s) 117
BpuEI CTTGAG 2 cut(s) 227, 247
BsaBI GATNNNNATC 1 cut(s) 177
BsaI GGTCTC 1 cut(s) 194
Bse1I ACTGG 1 cut(s) 92
Bse8I GATNNNNATC 1 cut(s) 177
BseBI CCWGG 1 cut(s) 142
BseJI GATNNNNATC 1 cut(s) 177
BseNI ACTGG 1 cut(s) 92
BseRI GAGGAG 1 cut(s) 110
BseXI GCAGC 2 cut(s) 109, 264
BseYI CCCAGC 1 cut(s) 212
BsiSI CCGG 1 cut(s) 83
BsmAI GTCTC 1 cut(s) 194
Bso31I GGTCTC 1 cut(s) 194
Bsp143I GATC 3 cut(s) 178, 225, 295
BspACI CCGC 3 cut(s) 8, 204, 267
BspMAI CTGCAG 2 cut(s) 99, 254
BspMI ACCTGC 2 cut(s) 24, 257
BspPI GGATC 1 cut(s) 233
BspTNI GGTCTC 1 cut(s) 194
BsrI ACTGG 1 cut(s) 92
BssMI GATC 3 cut(s) 178, 225, 295
Bst2UI CCWGG 1 cut(s) 142
Bst4CI ACNGT 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 70
BstH2I RGCGCY 1 cut(s) 258
BstHHI GCGC 1 cut(s) 257
BstKTI GATC 3 cut(s) 181, 228, 298
BstMAI GTCTC 1 cut(s) 194
BstMBI GATC 3 cut(s) 178, 225, 295
BstMWI GCNNNNNNNGC 2 cut(s) 146, 203
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstSFI CTRYAG 2 cut(s) 95, 250
BstV1I GCAGC 2 cut(s) 109, 264
BstV2I GAAGAC 1 cut(s) 117
BveI ACCTGC 2 cut(s) 24, 257
CfoI GCGC 1 cut(s) 257
Cfr13I GGNCC 1 cut(s) 10
CseI GACGC 1 cut(s) 8
CviJI RGCY 2 cut(s) 100, 216
CviKI_1 RGCY 2 cut(s) 100, 216
DdeI CTNAG 1 cut(s) 70
DpnI GATC 3 cut(s) 180, 227, 297
DpnII GATC 3 cut(s) 178, 225, 295
EciI GGCGGA 1 cut(s) 23
Eco31I GGTCTC 1 cut(s) 194
Eco47I GGWCC 1 cut(s) 10
EcoRII CCWGG 1 cut(s) 140
FaiI YATR 2 cut(s) 294, 310
Fnu4HI GCNGC 3 cut(s) 98, 253, 268
Fsp4HI GCNGC 3 cut(s) 98, 253, 268
FspBI CTAG 1 cut(s) 23
GlaI GCGC 1 cut(s) 256
GluI GCNGC 3 cut(s) 98, 253, 268
GsaI CCCAGC 1 cut(s) 216
HaeII RGCGCY 1 cut(s) 258
HapII CCGG 1 cut(s) 83
HgaI GACGC 1 cut(s) 8
HhaI GCGC 1 cut(s) 257
Hin6I GCGC 1 cut(s) 255
HinP1I GCGC 1 cut(s) 255
HinfI GANTC 3 cut(s) 91, 173, 238
HpaII CCGG 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 3 cut(s) 178, 183, 237
Hpy188III TCNNGA 1 cut(s) 244
Hpy8I GTNNAC 1 cut(s) 52
Hpy99I CGWCG 2 cut(s) 280, 283
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 2 cut(s) 97, 252
HpyF10VI GCNNNNNNNGC 2 cut(s) 146, 203
HpyF3I CTNAG 1 cut(s) 70
HspAI GCGC 1 cut(s) 255
Kzo9I GATC 3 cut(s) 178, 225, 295
Lsp1109I GCAGC 2 cut(s) 109, 264
MaeI CTAG 1 cut(s) 23
MaeIII GTNAC 2 cut(s) 43, 271
MalI GATC 3 cut(s) 180, 227, 297
MboI GATC 3 cut(s) 178, 225, 295
MboII GAAGA 3 cut(s) 119, 122, 182
MluCI AATT 3 cut(s) 125, 133, 220
MnlI CCTC 3 cut(s) 128, 131, 241
MslI CAYNNNNRTG 1 cut(s) 307
MspA1I CMGCKG 1 cut(s) 216
MspI CCGG 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 142
MvaI CCWGG 1 cut(s) 142
MwoI GCNNNNNNNGC 2 cut(s) 146, 203
NdeII GATC 3 cut(s) 178, 225, 295
PaqCI CACCTGC 1 cut(s) 24
PfeI GAWTC 3 cut(s) 91, 173, 238
PkrI GCNGC 3 cut(s) 99, 254, 269
Psp6I CCWGG 1 cut(s) 140
PspFI CCCAGC 1 cut(s) 212
PspGI CCWGG 1 cut(s) 140
PspPI GGNCC 1 cut(s) 10
PstI CTGCAG 2 cut(s) 99, 254
PvuII CAGCTG 1 cut(s) 216
RseI CAYNNNNRTG 1 cut(s) 307
SatI GCNGC 3 cut(s) 98, 253, 268
Sau3AI GATC 3 cut(s) 178, 225, 295
Sau96I GGNCC 1 cut(s) 10
ScrFI CCNGG 1 cut(s) 142
SetI ASST 5 cut(s) 18, 146, 218, 251, 309
SfcI CTRYAG 2 cut(s) 95, 250
SinI GGWCC 1 cut(s) 10
SmiMI CAYNNNNRTG 1 cut(s) 307
SmlI CTYRAG 2 cut(s) 242, 262
SmoI CTYRAG 2 cut(s) 242, 262
Sse9I AATT 3 cut(s) 125, 133, 220
SsiI CCGC 3 cut(s) 8, 204, 267
SspMI CTAG 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 140
TaaI ACNGT 1 cut(s) 49
TaqI TCGA 1 cut(s) 75
TasI AATT 3 cut(s) 125, 133, 220
TauI GCSGC 1 cut(s) 270
TfiI GAWTC 3 cut(s) 91, 173, 238
TseI GCWGC 2 cut(s) 97, 252
TspDTI ATGAA 2 cut(s) 80, 118
VpaK11BI GGWCC 1 cut(s) 10
XapI RAATTY 1 cut(s) 125
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.