Rroxscaffold_5G00342510

Cell division control protein 24, OB domain 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0017434
Physical Location & Seq
Reverse (-)
11467035 .. 11470063
3029 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00342510.1

Sequence Viewer

Length: 336 bp
ATGTCGGAATGTGTGAAGCAATTGCAAAAGAAGCATAAGCGAAGGAAGCTTTCGAACACTGTGACTATTGATTCCATTTACGAGAAGAATTTCTTGTCCTTGAATAGTGCTTTGGAAGCAGTGATTGTCGACGTTTTCTTAGAAAAGTCGCCGATGTCCTCGTGGAGGCCACGGAGCGCCAAGACCTACACCGGCGGTGCGTTGATTGAGATGCACCAAGACCTCATGCACTCCACCACCATCGTAACGTCCTTCCCCTCCGGCGGGGAGGAGTCATCGCCGCCGAGGGTATTTTCGAGTTCTCATAATTCGGGATTGAAATCCATGGAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CDC24_OB1 CDC24_OB2 CDC24_OB3

Protein Analysis

111

Amino Acids

12.4

Weight (kDa)

8.79

Isoelectric Point (pI)

79.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CDC24_OB1 PF17246 6 - 48 1e-11 Cell division control protein 24, OB domain 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 129
AciI CCGC 3 cut(s) 195, 264, 281
AcsI RAATTY 1 cut(s) 88
AfiI CCNNNNNNNGG 3 cut(s) 165, 263, 264
AgsI TTSAA 2 cut(s) 103, 319
AjuI GAANNNNNNNTTGG 2 cut(s) 95, 127
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AoxI GGCC 1 cut(s) 167
ApoI RAATTY 1 cut(s) 88
Asp700I GAANNNNTTC 1 cut(s) 89
AspLEI GCGC 1 cut(s) 179
AsuII TTCGAA 1 cut(s) 53
BauI CACGAG 1 cut(s) 160
BccI CCATC 1 cut(s) 248
BfoI RGCGCY 1 cut(s) 180
BisI GCNGC 1 cut(s) 281
BlsI GCNGC 1 cut(s) 282
BmsI GCATC 1 cut(s) 201
Bpu14I TTCGAA 1 cut(s) 53
BsaBI GATNNNNATC 1 cut(s) 319
BsaJI CCNNGG 3 cut(s) 170, 284, 324
Bsc4I CCNNNNNNNGG 3 cut(s) 165, 263, 264
Bse118I RCCGGY 1 cut(s) 191
Bse8I GATNNNNATC 1 cut(s) 319
BseDI CCNNGG 3 cut(s) 170, 284, 324
BseJI GATNNNNATC 1 cut(s) 319
BseLI CCNNNNNNNGG 3 cut(s) 165, 263, 264
BseRI GAGGAG 1 cut(s) 284
BshFI GGCC 1 cut(s) 169
BsiSI CCGG 2 cut(s) 192, 261
BslI CCNNNNNNNGG 3 cut(s) 165, 263, 264
BsnI GGCC 1 cut(s) 169
Bsp119I TTCGAA 1 cut(s) 53
Bsp19I CCATGG 1 cut(s) 324
BspACI CCGC 3 cut(s) 195, 264, 281
BspANI GGCC 1 cut(s) 169
BspT104I TTCGAA 1 cut(s) 53
BsrFI RCCGGY 1 cut(s) 191
BssAI RCCGGY 1 cut(s) 191
BssECI CCNNGG 3 cut(s) 170, 284, 324
BssSI CACGAG 1 cut(s) 160
BssT1I CCWWGG 1 cut(s) 324
Bst2BI CACGAG 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 61
BstBI TTCGAA 1 cut(s) 53
BstDEI CTNAG 1 cut(s) 139
BstDSI CCRYGG 2 cut(s) 170, 324
BstENI CCTNNNNNAGG 1 cut(s) 163
BstH2I RGCGCY 1 cut(s) 180
BstHHI GCGC 1 cut(s) 179
BstMWI GCNNNNNNNGC 3 cut(s) 31, 46, 116
BsuRI GGCC 1 cut(s) 169
BtgI CCRYGG 2 cut(s) 170, 324
BtgZI GCGATG 1 cut(s) 261
BtsI GCAGTG 1 cut(s) 126
BtsIMutI CAGTG 2 cut(s) 57, 126
CfoI GCGC 1 cut(s) 179
Cfr10I RCCGGY 1 cut(s) 191
CviAII CATG 2 cut(s) 226, 325
CviJI RGCY 2 cut(s) 49, 169
CviKI_1 RGCY 2 cut(s) 49, 169
DdeI CTNAG 1 cut(s) 139
Eco130I CCWWGG 1 cut(s) 324
EcoNI CCTNNNNNAGG 1 cut(s) 163
EcoT14I CCWWGG 1 cut(s) 324
ErhI CCWWGG 1 cut(s) 324
FaeI CATG 2 cut(s) 229, 328
FaiI YATR 4 cut(s) 36, 227, 306, 326
FalI AAGNNNNNCTT 2 cut(s) 77, 109
FatI CATG 2 cut(s) 225, 324
FauI CCCGC 1 cut(s) 257
FblI GTMKAC 1 cut(s) 129
Fnu4HI GCNGC 1 cut(s) 281
Fsp4HI GCNGC 1 cut(s) 281
GlaI GCGC 1 cut(s) 178
GluI GCNGC 1 cut(s) 281
HaeII RGCGCY 1 cut(s) 180
HaeIII GGCC 1 cut(s) 169
HapII CCGG 2 cut(s) 192, 261
HhaI GCGC 1 cut(s) 179
Hin1II CATG 2 cut(s) 229, 328
Hin6I GCGC 1 cut(s) 177
HinP1I GCGC 1 cut(s) 177
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HindIII AAGCTT 1 cut(s) 47
HinfI GANTC 2 cut(s) 71, 272
HpaII CCGG 2 cut(s) 192, 261
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 312
Hpy8I GTNNAC 1 cut(s) 130
Hpy99I CGWCG 1 cut(s) 134
HpyAV CCTTC 2 cut(s) 36, 262
HpyCH4III ACNGT 1 cut(s) 61
HpyCH4IV ACGT 2 cut(s) 132, 248
HpyCH4V TGCA 3 cut(s) 25, 214, 229
HpyF10VI GCNNNNNNNGC 3 cut(s) 31, 46, 116
HpyF3I CTNAG 1 cut(s) 139
HpySE526I ACGT 2 cut(s) 132, 248
Hsp92II CATG 2 cut(s) 229, 328
HspAI GCGC 1 cut(s) 177
LmnI GCTCC 1 cut(s) 174
LpnPI CCDG 2 cut(s) 205, 274
LweI GCATC 1 cut(s) 201
MaeII ACGT 2 cut(s) 132, 248
MaeIII GTNAC 2 cut(s) 61, 244
MboII GAAGA 1 cut(s) 97
MfeI CAATTG 1 cut(s) 20
MluCI AATT 3 cut(s) 20, 88, 307
MlyI GAGTC 1 cut(s) 281
MnlI CCTC 6 cut(s) 159, 169, 233, 262, 268, 279
MroXI GAANNNNTTC 1 cut(s) 89
MspI CCGG 2 cut(s) 192, 261
MunI CAATTG 1 cut(s) 20
MwoI GCNNNNNNNGC 3 cut(s) 31, 46, 116
NcoI CCATGG 1 cut(s) 324
NlaIII CATG 2 cut(s) 229, 328
NmeAIII GCCGAG 1 cut(s) 309
NmuCI GTSAC 1 cut(s) 61
NspV TTCGAA 1 cut(s) 53
PdmI GAANNNNTTC 1 cut(s) 89
PfeI GAWTC 1 cut(s) 71
PkrI GCNGC 1 cut(s) 282
PleI GAGTC 1 cut(s) 280
PpsI GAGTC 1 cut(s) 280
SalI GTCGAC 1 cut(s) 128
SatI GCNGC 1 cut(s) 281
SchI GAGTC 1 cut(s) 281
SetI ASST 5 cut(s) 51, 135, 188, 225, 251
SfaNI GCATC 1 cut(s) 201
SfuI TTCGAA 1 cut(s) 53
SgrAI CRCCGGYG 1 cut(s) 191
Sse9I AATT 3 cut(s) 20, 88, 307
SsiI CCGC 3 cut(s) 195, 264, 281
StyI CCWWGG 1 cut(s) 324
TaaI ACNGT 1 cut(s) 61
TaiI ACGT 2 cut(s) 135, 251
TaqI TCGA 3 cut(s) 53, 129, 296
TasI AATT 3 cut(s) 20, 88, 307
TauI GCSGC 1 cut(s) 283
TfiI GAWTC 1 cut(s) 71
TscAI CASTG 2 cut(s) 64, 126
TseFI GTSAC 1 cut(s) 61
Tsp45I GTSAC 1 cut(s) 61
TspGWI ACGGA 1 cut(s) 187
TspRI CASTG 2 cut(s) 64, 126
XagI CCTNNNNNAGG 1 cut(s) 163
XapI RAATTY 1 cut(s) 88
XmiI GTMKAC 1 cut(s) 129
XmnI GAANNNNTTC 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.