Rmu_co8065596.1_g000001

Peptidyl-prolyl cis-trans isomerase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8065596.1
Physical Location & Seq
Reverse (-)
1 .. 483
483 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8065596.1_g000001.1.cds

Sequence Viewer

Length: 223 bp
atgagttatccggactacaccgaaactgaatcgggtcttcagtataaggacttgcgagcaggagatggccccaaacccaaggttggggatacagtagtgattgattgggatggttataccattggatactacggtcgtatatttgaagctcgaaataaaacaaaaggtggttcatttgaggtattgattacttatgatctgtttactggggacttatttcggg

Protein Analysis

74

Amino Acids

8.4

Weight (kDa)

4.69

Isoelectric Point (pI)

28.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 23
AfiI CCNNNNNNNGG 2 cut(s) 83, 84
AgsI TTSAA 1 cut(s) 146
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
Aor13HI TCCGGA 1 cut(s) 10
AoxI GGCC 1 cut(s) 67
AspS9I GGNCC 1 cut(s) 68
BaeI ACNNNNGTAYC 4 cut(s) 81, 114, 118, 151
BbsI GAAGAC 1 cut(s) 29
BccI CCATC 2 cut(s) 59, 104
BciVI GTATCC 2 cut(s) 82, 119
BfuI GTATCC 2 cut(s) 82, 119
BmgT120I GGNCC 1 cut(s) 68
BmiI GGNNCC 1 cut(s) 70
BmrI ACTGGG 1 cut(s) 216
BmuI ACTGGG 1 cut(s) 216
BpiI GAAGAC 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 78
BsaWI WCCGGW 1 cut(s) 10
Bsc4I CCNNNNNNNGG 2 cut(s) 83, 84
Bse1I ACTGG 1 cut(s) 211
BseAI TCCGGA 1 cut(s) 10
BseDI CCNNGG 1 cut(s) 78
BseGI GGATG 1 cut(s) 115
BseLI CCNNNNNNNGG 2 cut(s) 83, 84
BseNI ACTGG 1 cut(s) 211
Bsh1285I CGRYCG 1 cut(s) 136
BshFI GGCC 1 cut(s) 69
BsiEI CGRYCG 1 cut(s) 136
BsiSI CCGG 1 cut(s) 11
BslI CCNNNNNNNGG 2 cut(s) 83, 84
BsnI GGCC 1 cut(s) 69
Bsp13I TCCGGA 1 cut(s) 10
Bsp143I GATC 1 cut(s) 196
BspANI GGCC 1 cut(s) 69
BspEI TCCGGA 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 70
BsrI ACTGG 1 cut(s) 211
BssECI CCNNGG 1 cut(s) 78
BssMI GATC 1 cut(s) 196
BssT1I CCWWGG 1 cut(s) 78
Bst4CI ACNGT 2 cut(s) 94, 134
BstC8I GCNNGC 1 cut(s) 57
BstF5I GGATG 1 cut(s) 115
BstKTI GATC 1 cut(s) 199
BstMBI GATC 1 cut(s) 196
BstMCI CGRYCG 1 cut(s) 136
BstV2I GAAGAC 1 cut(s) 29
BsuI GTATCC 2 cut(s) 82, 119
BsuRI GGCC 1 cut(s) 69
BtsCI GGATG 1 cut(s) 115
Cac8I GCNNGC 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 68
CviJI RGCY 2 cut(s) 69, 149
CviKI_1 RGCY 2 cut(s) 69, 149
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
Eco130I CCWWGG 1 cut(s) 78
Eco57I CTGAAG 1 cut(s) 23
EcoT14I CCWWGG 1 cut(s) 78
ErhI CCWWGG 1 cut(s) 78
FaiI YATR 4 cut(s) 45, 117, 140, 195
FokI GGATG 1 cut(s) 122
HaeIII GGCC 1 cut(s) 69
HapII CCGG 1 cut(s) 11
HinfI GANTC 1 cut(s) 29
HpaII CCGG 1 cut(s) 11
Hpy166II GTNNAC 1 cut(s) 204
Hpy188III TCNNGA 1 cut(s) 11
Hpy8I GTNNAC 1 cut(s) 204
HpyCH4III ACNGT 2 cut(s) 94, 134
Kpn2I TCCGGA 1 cut(s) 10
Kzo9I GATC 1 cut(s) 196
LpnPI CCDG 3 cut(s) 24, 45, 192
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MboII GAAGA 1 cut(s) 29
MnlI CCTC 1 cut(s) 172
MroI TCCGGA 1 cut(s) 10
MspI CCGG 1 cut(s) 11
NdeII GATC 1 cut(s) 196
NlaIV GGNNCC 1 cut(s) 70
PfeI GAWTC 1 cut(s) 29
PspN4I GGNNCC 1 cut(s) 70
PspPI GGNCC 1 cut(s) 68
Sau3AI GATC 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 68
SetI ASST 4 cut(s) 84, 151, 169, 183
SgeI CNNG 8 cut(s) 23, 45, 64, 68, 72, 91, 162, 219
StyI CCWWGG 1 cut(s) 78
TaaI ACNGT 2 cut(s) 94, 134
TaqI TCGA 1 cut(s) 151
TfiI GAWTC 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.