Rmu_co8074946.1_g000001

Histone-lysine n-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8074946.1
Physical Location & Seq
Forward (+)
1 .. 579
579 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8074946.1_g000001.1.cds

Sequence Viewer

Length: 264 bp
gtgtgggccacagcctaattcaaaattgcttataaattacggttttgttgacgaagataattcttatgaccgtttgatggttgaggcagctttgaatactgaggatccacaatatcaagataaaagaatggttgctcagagaaatggaaaattatcagtacaagcttttcaggtatatgtcgggaaggaaaaggaaactgtctcggatatgcttccctatctgcgactaggctatgtttcagatccttcggagatgcagtctgt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.01

Weight (kDa)

4.62

Isoelectric Point (pI)

30.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 33
AclWI GGATC 3 cut(s) 99, 112, 237
AfaI GTAC 1 cut(s) 160
AfiI CCNNNNNNNGG 1 cut(s) 77
AgsI TTSAA 2 cut(s) 22, 95
AluBI AGCT 2 cut(s) 90, 165
AluI AGCT 2 cut(s) 90, 165
Alw26I GTCTC 1 cut(s) 206
AlwI GGATC 3 cut(s) 99, 112, 237
AoxI GGCC 1 cut(s) 6
ApeKI GCWGC 1 cut(s) 87
AspS9I GGNCC 1 cut(s) 6
BamHI GGATCC 1 cut(s) 104
BbvI GCAGC 1 cut(s) 99
BccI CCATC 1 cut(s) 71
BcoDI GTCTC 1 cut(s) 206
BfaI CTAG 1 cut(s) 228
BisI GCNGC 1 cut(s) 88
BlsI GCNGC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 6
BmiI GGNNCC 1 cut(s) 106
BmsI GCATC 1 cut(s) 244
BsaXI ACNNNNNCTCC 1 cut(s) 243
Bsc4I CCNNNNNNNGG 1 cut(s) 77
BseLI CCNNNNNNNGG 1 cut(s) 77
BseMII CTCAG 2 cut(s) 91, 150
BseXI GCAGC 1 cut(s) 99
BshFI GGCC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 77
BsmAI GTCTC 1 cut(s) 206
BsnI GGCC 1 cut(s) 8
Bsp143I GATC 2 cut(s) 104, 242
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 2 cut(s) 92, 149
BspLI GGNNCC 1 cut(s) 106
BspPI GGATC 3 cut(s) 99, 112, 237
BssMI GATC 2 cut(s) 104, 242
Bst4CI ACNGT 3 cut(s) 42, 72, 200
BstDEI CTNAG 2 cut(s) 100, 136
BstKTI GATC 2 cut(s) 107, 245
BstMAI GTCTC 1 cut(s) 206
BstMBI GATC 2 cut(s) 104, 242
BstV1I GCAGC 1 cut(s) 99
BstX2I RGATCY 2 cut(s) 104, 242
BstYI RGATCY 2 cut(s) 104, 242
BsuRI GGCC 1 cut(s) 8
Cfr13I GGNCC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 159
CviJI RGCY 5 cut(s) 8, 14, 90, 165, 232
CviKI_1 RGCY 5 cut(s) 8, 14, 90, 165, 232
CviQI GTAC 1 cut(s) 159
DdeI CTNAG 2 cut(s) 100, 136
DpnI GATC 2 cut(s) 106, 244
DpnII GATC 2 cut(s) 104, 242
FaiI YATR 6 cut(s) 33, 67, 176, 178, 210, 235
Fnu4HI GCNGC 1 cut(s) 88
Fsp4HI GCNGC 1 cut(s) 88
FspBI CTAG 1 cut(s) 228
GluI GCNGC 1 cut(s) 88
HaeIII GGCC 1 cut(s) 8
HincII GTYRAC 1 cut(s) 50
HindII GTYRAC 1 cut(s) 50
HindIII AAGCTT 1 cut(s) 163
Hpy166II GTNNAC 1 cut(s) 50
Hpy188I TCNGA 4 cut(s) 139, 206, 242, 251
Hpy188III TCNNGA 2 cut(s) 117, 182
Hpy8I GTNNAC 1 cut(s) 50
HpyAV CCTTC 2 cut(s) 179, 256
HpyCH4III ACNGT 3 cut(s) 42, 72, 200
HpyCH4V TGCA 1 cut(s) 257
HpyF3I CTNAG 2 cut(s) 100, 136
Kzo9I GATC 2 cut(s) 104, 242
LpnPI CCDG 1 cut(s) 156
Lsp1109I GCAGC 1 cut(s) 99
LweI GCATC 1 cut(s) 244
MaeI CTAG 1 cut(s) 228
MalI GATC 2 cut(s) 106, 244
MboI GATC 2 cut(s) 104, 242
MboII GAAGA 1 cut(s) 66
MflI RGATCY 2 cut(s) 104, 242
MluCI AATT 5 cut(s) 17, 24, 35, 59, 150
MnlI CCTC 2 cut(s) 77, 95
NdeII GATC 2 cut(s) 104, 242
NlaIV GGNNCC 1 cut(s) 106
PkrI GCNGC 1 cut(s) 89
PsiI TTATAA 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 106
PspPI GGNCC 1 cut(s) 6
PsuI RGATCY 2 cut(s) 104, 242
RsaI GTAC 1 cut(s) 160
RsaNI GTAC 1 cut(s) 159
SatI GCNGC 1 cut(s) 88
Sau3AI GATC 2 cut(s) 104, 242
Sau96I GGNCC 1 cut(s) 6
SetI ASST 3 cut(s) 92, 167, 175
SfaNI GCATC 1 cut(s) 244
SgeI CNNG 6 cut(s) 129, 174, 183, 194, 215, 240
Sse9I AATT 5 cut(s) 17, 24, 35, 59, 150
SspMI CTAG 1 cut(s) 228
TaaI ACNGT 3 cut(s) 42, 72, 200
TasI AATT 5 cut(s) 17, 24, 35, 59, 150
TatI WGTACW 1 cut(s) 158
TseI GCWGC 1 cut(s) 87
XspI CTAG 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.