Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8084018.1

Orthogroup ID

OG0016456

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 517

Gene Structure 517 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8084018.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 331 bp

aaagcatgaggtagagcccaattcagcagttctctcatggtttactcagaccaaagttcaaagttctcagaatgagaagtgtagcataacaatttcattagaccagctaaaggatgctgacattttgccactaaaggacgtgcttatgtcaagtgactcatctcatattcatgcagttgacttatttctggaattccatagtgacctgggcacagaaagtgttgtggatttgatgaatggactcaatgcaaagcttcgagttgtcgatctccaggatttgtctttggggaaagaatttctgcggtttgtattcataattctcaatttatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000151 GO:0000209 GO:0000715 GO:0003674 GO:0003676 GO:0003677 GO:0003684 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0006139 GO:0006259 GO:0006281 GO:0006289 GO:0006293 GO:0006294 GO:0006296 GO:0006325 GO:0006464 GO:0006508 GO:0006513 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0006996 GO:0008150 GO:0008152 GO:0009314 GO:0009411 GO:0009416 GO:0009628 GO:0009987 GO:0010390 GO:0016043 GO:0016567 GO:0016569 GO:0016570 GO:0016574 GO:0016579 GO:0019538 GO:0022607 GO:0030054 GO:0031334 GO:0031461 GO:0031465 GO:0031974 GO:0031981 GO:0032446 GO:0032991 GO:0033522 GO:0033554 GO:0033683 GO:0034622 GO:0034641 GO:0034644 GO:0035518 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043254 GO:0043412 GO:0043687 GO:0043933 GO:0044085 GO:0044087 GO:0044089 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0044877 GO:0046483 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0050896 GO:0051128 GO:0051130 GO:0051276 GO:0051716 GO:0051865 GO:0065003 GO:0065004 GO:0065007 GO:0070013 GO:0070646 GO:0070647 GO:0070911 GO:0070914 GO:0071214 GO:0071478 GO:0071482 GO:0071704 GO:0071824 GO:0071840 GO:0080008 GO:0090304 GO:0090305 GO:0097159 GO:0104004 GO:1901360 GO:1901363 GO:1901564 GO:1902494 GO:1990234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

109

Amino Acids

12.24

Weight (kDa)

4.83

Isoelectric Point (pI)

39.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016456)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0254281 RchiOBHm_Chr6g0254361
rosa_laevigata	RLG00000014925
rosa_multiflora	Rmu_co8084018.1_g000001 Rmu_sc0003666.1_g000005 Rmu_sc0006565.1_g000003 Rmu_sc0007138.1_g000007 Rmu_sc0007138.1_g000008 Rmu_sc0007138.1_g000011 Rmu_sc0015027.1_g000001
rosa_roxburghii	Rroxscaffold_7G00210900
rosa_rugosa	Rorug04G0165100
rosa_samantha	Rh6AG068000 Rh6BG060900
rosa_wichuraiana	Rw6G006050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	302
AcsI	RAATTY	2 cut(s)	192, 294
AfiI	CCNNNNNNNGG	1 cut(s)	110
AgsI	TTSAA	1 cut(s)	60
AjiI	CACGTC	1 cut(s)	140
AjnI	CCWGG	2 cut(s)	205, 271
AluBI	AGCT	2 cut(s)	107, 254
AluI	AGCT	2 cut(s)	107, 254
ApoI	RAATTY	2 cut(s)	192, 294
BaeGI	GKGCMC	1 cut(s)	213
BanII	GRGCYC	1 cut(s)	19
BciT130I	CCWGG	2 cut(s)	207, 273
Bme1390I	CCNGG	2 cut(s)	207, 273
BmgBI	CACGTC	1 cut(s)	140
BmrFI	CCNGG	2 cut(s)	207, 273
BmsI	GCATC	1 cut(s)	104
BpmI	CTGGAG	1 cut(s)	255
BsaJI	CCNNGG	1 cut(s)	206
Bsc4I	CCNNNNNNNGG	1 cut(s)	110
BseBI	CCWGG	2 cut(s)	207, 273
BseDI	CCNNGG	1 cut(s)	206
BseGI	GGATG	1 cut(s)	119
BseLI	CCNNNNNNNGG	1 cut(s)	110
BseMII	CTCAG	2 cut(s)	60, 81
BseSI	GKGCMC	1 cut(s)	213
BslI	CCNNNNNNNGG	1 cut(s)	110
Bsp1286I	GDGCHC	2 cut(s)	19, 213
Bsp143I	GATC	1 cut(s)	266
BspACI	CCGC	1 cut(s)	302
BspCNI	CTCAG	2 cut(s)	59, 80
BssECI	CCNNGG	1 cut(s)	206
BssMI	GATC	1 cut(s)	266
Bst2UI	CCWGG	2 cut(s)	207, 273
BstDEI	CTNAG	2 cut(s)	46, 67
BstF5I	GGATG	1 cut(s)	119
BstKTI	GATC	1 cut(s)	269
BstMBI	GATC	1 cut(s)	266
BstNI	CCWGG	2 cut(s)	207, 273
BstSCI	CCNGG	2 cut(s)	205, 271
BstSLI	GKGCMC	1 cut(s)	213
BtrI	CACGTC	1 cut(s)	140
BtsCI	GGATG	1 cut(s)	119
CviAII	CATG	3 cut(s)	6, 37, 171
CviJI	RGCY	3 cut(s)	17, 107, 254
CviKI_1	RGCY	3 cut(s)	17, 107, 254
DdeI	CTNAG	2 cut(s)	46, 67
DpnI	GATC	1 cut(s)	268
DpnII	GATC	1 cut(s)	266
Eco24I	GRGCYC	1 cut(s)	19
EcoRI	GAATTC	1 cut(s)	192
EcoRII	CCWGG	2 cut(s)	205, 271
EcoT38I	GRGCYC	1 cut(s)	19
FaeI	CATG	3 cut(s)	9, 40, 174
FaiI	YATR	9 cut(s)	7, 38, 87, 147, 166, 172, 199, 315, 329
FatI	CATG	3 cut(s)	5, 36, 170
FokI	GGATG	1 cut(s)	126
FriOI	GRGCYC	1 cut(s)	19
GsuI	CTGGAG	1 cut(s)	255
Hin1II	CATG	3 cut(s)	9, 40, 174
HincII	GTYRAC	1 cut(s)	179
HindII	GTYRAC	1 cut(s)	179
HindIII	AAGCTT	1 cut(s)	252
HinfI	GANTC	2 cut(s)	156, 241
Hpy166II	GTNNAC	2 cut(s)	43, 179
Hpy188I	TCNGA	2 cut(s)	49, 70
Hpy188III	TCNNGA	1 cut(s)	189
Hpy8I	GTNNAC	2 cut(s)	43, 179
HpyCH4IV	ACGT	1 cut(s)	139
HpyCH4V	TGCA	2 cut(s)	174, 249
HpyF3I	CTNAG	2 cut(s)	46, 67
HpySE526I	ACGT	1 cut(s)	139
Hsp92II	CATG	3 cut(s)	9, 40, 174
Kzo9I	GATC	1 cut(s)	266
LpnPI	CCDG	6 cut(s)	117, 174, 192, 219, 258, 285
LweI	GCATC	1 cut(s)	104
MaeII	ACGT	1 cut(s)	139
MaeIII	GTNAC	2 cut(s)	153, 201
MalI	GATC	1 cut(s)	268
MboI	GATC	1 cut(s)	266
MhlI	GDGCHC	2 cut(s)	19, 213
MluCI	AATT	6 cut(s)	20, 91, 192, 294, 316, 323
MlyI	GAGTC	2 cut(s)	150, 235
MslI	CAYNNNNRTG	1 cut(s)	169
MspR9I	CCNGG	2 cut(s)	207, 273
MvaI	CCWGG	2 cut(s)	207, 273
NdeII	GATC	1 cut(s)	266
NlaIII	CATG	3 cut(s)	9, 40, 174
NmuCI	GTSAC	2 cut(s)	153, 201
PfoI	TCCNGGA	1 cut(s)	271
PleI	GAGTC	2 cut(s)	150, 235
PpsI	GAGTC	2 cut(s)	150, 235
Psp6I	CCWGG	2 cut(s)	205, 271
PspGI	CCWGG	2 cut(s)	205, 271
RseI	CAYNNNNRTG	1 cut(s)	169
Sau3AI	GATC	1 cut(s)	266
SchI	GAGTC	2 cut(s)	150, 235
ScrFI	CCNGG	2 cut(s)	207, 273
SduI	GDGCHC	2 cut(s)	19, 213
SetI	ASST	5 cut(s)	13, 109, 142, 208, 256
SfaNI	GCATC	1 cut(s)	104
SmiMI	CAYNNNNRTG	1 cut(s)	169
Sse9I	AATT	6 cut(s)	20, 91, 192, 294, 316, 323
SsiI	CCGC	1 cut(s)	302
StyD4I	CCNGG	2 cut(s)	205, 271
TaiI	ACGT	1 cut(s)	142
TaqI	TCGA	2 cut(s)	257, 265
TasI	AATT	6 cut(s)	20, 91, 192, 294, 316, 323
TseFI	GTSAC	2 cut(s)	153, 201
Tsp45I	GTSAC	2 cut(s)	153, 201
TspDTI	ATGAA	4 cut(s)	85, 159, 249, 302
XapI	RAATTY	2 cut(s)	192, 294

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.