Rmu_co8113914.1_g000001

Proline-rich nuclear receptor coactivator motif

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8113914.1
Physical Location & Seq
Reverse (-)
136 .. 586
451 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8113914.1_g000001.1.cds

Sequence Viewer

Length: 405 bp
atgccccccttctgcttattcacccaagacacctacacctataaagctgtgagtagaagcaatgtgagaaccaacccaattcctatcaatgcccgaaacctgaagaaagagaagccttttaatgagagtttttcattttcggaactctgggctggtcctgcttactcaaactctcccccacctagttctttgccaatacccaaattttcagttcggccaaagaggaccgtgtcgcttgaattgcctagctcagtttctgctattgaaatgcacccaattgccaggtctgcacccccgtccccgaccagagagcatagctcttccaaaagagatctctttcacaatgctgactcagccactaggactctgcgtcgcatcctcaacctggatgttgacgacgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

15.05

Weight (kDa)

9.66

Isoelectric Point (pI)

75.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011970)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 215
AcsI RAATTY 1 cut(s) 203
AcuI CTGAAG 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 385
AgsI TTSAA 2 cut(s) 239, 266
AhdI GACNNNNNGTC 1 cut(s) 369
AjnI CCWGG 2 cut(s) 281, 384
AluBI AGCT 3 cut(s) 47, 249, 318
AluI AGCT 3 cut(s) 47, 249, 318
AlwNI CAGNNNCTG 1 cut(s) 257
AoxI GGCC 1 cut(s) 215
ApoI RAATTY 1 cut(s) 203
AspS9I GGNCC 2 cut(s) 155, 225
AsuHPI GGTGA 1 cut(s) 13
AvaII GGWCC 2 cut(s) 155, 225
BciT130I CCWGG 2 cut(s) 283, 386
BfaI CTAG 3 cut(s) 183, 246, 360
BglII AGATCT 1 cut(s) 331
Bme1390I CCNGG 2 cut(s) 283, 386
Bme18I GGWCC 2 cut(s) 155, 225
BmeRI GACNNNNNGTC 1 cut(s) 369
BmgT120I GGNCC 2 cut(s) 155, 225
BmrFI CCNGG 2 cut(s) 283, 386
BmsI GCATC 1 cut(s) 384
BplI GAGNNNNNCTC 2 cut(s) 302, 334
Bsc4I CCNNNNNNNGG 1 cut(s) 385
Bse3DI GCAATG 1 cut(s) 67
BseBI CCWGG 2 cut(s) 283, 386
BseGI GGATG 2 cut(s) 375, 394
BseLI CCNNNNNNNGG 1 cut(s) 385
BseMI GCAATG 1 cut(s) 67
BseMII CTCAG 2 cut(s) 264, 366
BsgI GTGCAG 1 cut(s) 273
BshFI GGCC 1 cut(s) 217
BslFI GGGAC 1 cut(s) 283
BslI CCNNNNNNNGG 1 cut(s) 385
BsmFI GGGAC 1 cut(s) 283
BsnI GGCC 1 cut(s) 217
Bsp143I GATC 1 cut(s) 331
BspANI GGCC 1 cut(s) 217
BspCNI CTCAG 2 cut(s) 263, 365
BspQI GCTCTTC 1 cut(s) 325
BsrDI GCAATG 1 cut(s) 67
BssMI GATC 1 cut(s) 331
Bst2UI CCWGG 2 cut(s) 283, 386
Bst4CI ACNGT 1 cut(s) 229
Bst6I CTCTTC 1 cut(s) 325
BstDEI CTNAG 2 cut(s) 250, 352
BstF5I GGATG 2 cut(s) 375, 394
BstKTI GATC 1 cut(s) 334
BstMBI GATC 1 cut(s) 331
BstMWI GCNNNNNNNGC 4 cut(s) 158, 241, 287, 353
BstNI CCWGG 2 cut(s) 283, 386
BstSCI CCNGG 2 cut(s) 281, 384
BstX2I RGATCY 1 cut(s) 331
BstYI RGATCY 1 cut(s) 331
BsuRI GGCC 1 cut(s) 217
BtsCI GGATG 2 cut(s) 375, 394
CaiI CAGNNNCTG 1 cut(s) 257
Cfr13I GGNCC 2 cut(s) 155, 225
CseI GACGC 1 cut(s) 359
CviJI RGCY 7 cut(s) 47, 115, 152, 217, 249, 318, 356
CviKI_1 RGCY 7 cut(s) 47, 115, 152, 217, 249, 318, 356
DdeI CTNAG 2 cut(s) 250, 352
DpnI GATC 1 cut(s) 333
DpnII GATC 1 cut(s) 331
DriI GACNNNNNGTC 1 cut(s) 369
EaeI YGGCCR 1 cut(s) 215
Eam1104I CTCTTC 1 cut(s) 325
Eam1105I GACNNNNNGTC 1 cut(s) 369
EarI CTCTTC 1 cut(s) 325
Eco47I GGWCC 2 cut(s) 155, 225
Eco57I CTGAAG 1 cut(s) 122
EcoRII CCWGG 2 cut(s) 281, 384
FaiI YATR 2 cut(s) 42, 315
FaqI GGGAC 1 cut(s) 283
FokI GGATG 2 cut(s) 362, 401
FspBI CTAG 3 cut(s) 183, 246, 360
HaeIII GGCC 1 cut(s) 217
HgaI GACGC 1 cut(s) 359
HincII GTYRAC 1 cut(s) 394
HindII GTYRAC 1 cut(s) 394
HinfI GANTC 2 cut(s) 350, 364
HphI GGTGA 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 394
Hpy188I TCNGA 1 cut(s) 142
Hpy8I GTNNAC 1 cut(s) 394
Hpy99I CGWCG 2 cut(s) 375, 401
HpyAV CCTTC 1 cut(s) 19
HpyCH4III ACNGT 1 cut(s) 229
HpyCH4V TGCA 2 cut(s) 271, 290
HpyF10VI GCNNNNNNNGC 4 cut(s) 158, 241, 287, 353
HpyF3I CTNAG 2 cut(s) 250, 352
Kzo9I GATC 1 cut(s) 331
LguI GCTCTTC 1 cut(s) 325
LpnPI CCDG 9 cut(s) 113, 133, 138, 171, 268, 295, 319, 371, 398
LweI GCATC 1 cut(s) 384
MaeI CTAG 3 cut(s) 183, 246, 360
MalI GATC 1 cut(s) 333
MboI GATC 1 cut(s) 331
MboII GAAGA 2 cut(s) 115, 312
MfeI CAATTG 1 cut(s) 276
MflI RGATCY 1 cut(s) 331
MluCI AATT 4 cut(s) 78, 203, 239, 276
MlyI GAGTC 2 cut(s) 344, 358
MnlI CCTC 2 cut(s) 216, 389
MseI TTAA 1 cut(s) 120
MspR9I CCNGG 2 cut(s) 283, 386
MunI CAATTG 1 cut(s) 276
MvaI CCWGG 2 cut(s) 283, 386
MwoI GCNNNNNNNGC 4 cut(s) 158, 241, 287, 353
NdeII GATC 1 cut(s) 331
PciSI GCTCTTC 1 cut(s) 325
PflFI GACNNNGTC 1 cut(s) 229
PleI GAGTC 2 cut(s) 344, 358
PpsI GAGTC 2 cut(s) 344, 358
Psp6I CCWGG 2 cut(s) 281, 384
PspGI CCWGG 2 cut(s) 281, 384
PspPI GGNCC 2 cut(s) 155, 225
PstNI CAGNNNCTG 1 cut(s) 257
PsuI RGATCY 1 cut(s) 331
PsyI GACNNNGTC 1 cut(s) 229
SapI GCTCTTC 1 cut(s) 325
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 1 cut(s) 331
Sau96I GGNCC 2 cut(s) 155, 225
SchI GAGTC 2 cut(s) 344, 358
ScrFI CCNGG 2 cut(s) 283, 386
SetI ASST 9 cut(s) 35, 41, 49, 102, 184, 251, 287, 320, 387
SfaNI GCATC 1 cut(s) 384
SinI GGWCC 2 cut(s) 155, 225
Sse9I AATT 4 cut(s) 78, 203, 239, 276
SspMI CTAG 3 cut(s) 183, 246, 360
StyD4I CCNGG 2 cut(s) 281, 384
TaaI ACNGT 1 cut(s) 229
TasI AATT 4 cut(s) 78, 203, 239, 276
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 123
Tth111I GACNNNGTC 1 cut(s) 229
VpaK11BI GGWCC 2 cut(s) 155, 225
XapI RAATTY 1 cut(s) 203
XspI CTAG 3 cut(s) 183, 246, 360
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.