Rmu_co8115700.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8115700.1
Physical Location & Seq
Forward (+)
1 .. 571
571 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8115700.1_g000001.1.cds

Sequence Viewer

Length: 299 bp
aagaggcagacaatgatgttacctgctcgggcttgcaaactttgggatcattgaacaaggtggagcttggtgaaagttgcattgtagtagactgtactgaacttgaatgcagttctggtgaagctattaagcgcaggtcttacaagaaaaaattgagggacgcatttgtttcaagaatgagactgttgaagaagcagaacaatgatgaactgaggaacagttttgcaacactcacactccctgagaaatcaaattcgcctgattatgaattttttgaatccgactgggaaattgtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.14

Weight (kDa)

4.87

Isoelectric Point (pI)

55.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 31, 125
AccI GTMKAC 1 cut(s) 89
AclWI GGATC 1 cut(s) 54
AcsI RAATTY 2 cut(s) 252, 268
AfaI GTAC 1 cut(s) 96
AgsI TTSAA 5 cut(s) 54, 106, 173, 189, 277
AluBI AGCT 2 cut(s) 66, 124
AluI AGCT 2 cut(s) 66, 124
Alw26I GTCTC 1 cut(s) 174
AlwI GGATC 1 cut(s) 54
Ama87I CYCGRG 1 cut(s) 27
ApoI RAATTY 2 cut(s) 252, 268
AspLEI GCGC 1 cut(s) 134
AsuHPI GGTGA 2 cut(s) 82, 130
AvaI CYCGRG 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 174
BfuAI ACCTGC 2 cut(s) 31, 125
BmeT110I CYCGRG 1 cut(s) 27
BmrI ACTGGG 1 cut(s) 294
BmuI ACTGGG 1 cut(s) 294
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
Bse1I ACTGG 1 cut(s) 289
BseMII CTCAG 2 cut(s) 202, 233
BseNI ACTGG 1 cut(s) 289
BsiHKCI CYCGRG 1 cut(s) 27
BslFI GGGAC 1 cut(s) 172
BsmAI GTCTC 1 cut(s) 174
BsmFI GGGAC 1 cut(s) 172
BsmI GAATGC 1 cut(s) 112
BsoBI CYCGRG 1 cut(s) 27
Bsp143I GATC 1 cut(s) 46
BspCNI CTCAG 2 cut(s) 203, 234
BspMI ACCTGC 2 cut(s) 31, 125
BspPI GGATC 1 cut(s) 54
BsrI ACTGG 1 cut(s) 289
BssMI GATC 1 cut(s) 46
Bst4CI ACNGT 3 cut(s) 94, 185, 220
BstC8I GCNNGC 1 cut(s) 34
BstDEI CTNAG 2 cut(s) 211, 242
BstHHI GCGC 1 cut(s) 134
BstKTI GATC 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 174
BstMBI GATC 1 cut(s) 46
BveI ACCTGC 2 cut(s) 31, 125
Cac8I GCNNGC 1 cut(s) 34
CfoI GCGC 1 cut(s) 134
CseI GACGC 1 cut(s) 169
Csp6I GTAC 1 cut(s) 95
CviJI RGCY 3 cut(s) 32, 66, 124
CviKI_1 RGCY 3 cut(s) 32, 66, 124
CviQI GTAC 1 cut(s) 95
DdeI CTNAG 2 cut(s) 211, 242
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eco88I CYCGRG 1 cut(s) 27
FaiI YATR 1 cut(s) 266
FaqI GGGAC 1 cut(s) 172
FblI GTMKAC 1 cut(s) 89
GlaI GCGC 1 cut(s) 133
HgaI GACGC 1 cut(s) 169
HhaI GCGC 1 cut(s) 134
Hin6I GCGC 1 cut(s) 132
HinP1I GCGC 1 cut(s) 132
HinfI GANTC 1 cut(s) 277
HphI GGTGA 2 cut(s) 82, 130
Hpy166II GTNNAC 1 cut(s) 90
Hpy188I TCNGA 1 cut(s) 282
Hpy188III TCNNGA 1 cut(s) 173
Hpy8I GTNNAC 1 cut(s) 90
HpyCH4III ACNGT 3 cut(s) 94, 185, 220
HpyCH4V TGCA 4 cut(s) 36, 80, 110, 226
HpyF3I CTNAG 2 cut(s) 211, 242
HspAI GCGC 1 cut(s) 132
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 1 cut(s) 63
LpnPI CCDG 6 cut(s) 36, 101, 120, 254, 270, 272
MaeIII GTNAC 1 cut(s) 18
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 201
MluCI AATT 4 cut(s) 151, 252, 268, 290
MnlI CCTC 2 cut(s) 149, 206
MseI TTAA 1 cut(s) 128
Mva1269I GAATGC 1 cut(s) 112
NdeII GATC 1 cut(s) 46
PctI GAATGC 1 cut(s) 112
PfeI GAWTC 1 cut(s) 277
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 1 cut(s) 46
SetI ASST 5 cut(s) 25, 62, 68, 126, 139
Sse9I AATT 4 cut(s) 151, 252, 268, 290
TaaI ACNGT 3 cut(s) 94, 185, 220
TasI AATT 4 cut(s) 151, 252, 268, 290
TatI WGTACW 1 cut(s) 94
TfiI GAWTC 1 cut(s) 277
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TspDTI ATGAA 2 cut(s) 221, 281
XapI RAATTY 2 cut(s) 252, 268
XmiI GTMKAC 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.