Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8131438.1

Orthogroup ID

OG0005915

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 491

Gene Structure 490 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8131438.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 490 bp

atgcgaggtcgcaaacgcaagtgctctggtgttgcaccttcaagagaagctcgtagagtccgaaggggtgaaaagaaaatcgactatgagatgatccaccatatggaagccgaggcttaccatgctgtcttgaaggcctttagtgctcaatctgatagtatctcttgggatcgggtggcgctgatgactaagctgcggaaggaacttaacattacagatgatgaacatggagagctactcgtgaagattaggcaatccgacgagtctatcagggcgttaagggaatggcgaaattcgaatgctactgctgctcaagagtttggtaatgtcgctaaaagatctggttttattcagatcggtgctacggatcaaatcattcatgaggttgagaagctgcttgacagtcaagatatcctctcccctgcgcaattggaacgggcaaacttggtccttcgacagcacgaaagggctatccttgaagcacttgatc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ENT

Protein Analysis

163

Amino Acids

18.69

Weight (kDa)

8.76

Isoelectric Point (pI)

48.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005915)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g24150 FvH4_4g24150 FvH4_4g24150 FvH4_4g24150 FvH4_6g03210
malus_domestica	MD14G1008100.v1.1
prunus_persica	Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1
pyrus_communis	pycom14g00640
rosa_chinensis	RchiOBHm_Chr4g0430921
rosa_laevigata	RLG00000006938
rosa_multiflora	Rmu_co8131438.1_g000001 Rmu_sc0006263.1_g000012 Rmu_sc0041372.1_g000001
rosa_roxburghii	Rroxscaffold_5G00372610
rosa_samantha	Rh4AG302900 Rh4AG303800 Rh4BG311100 Rh4CG327400 Rh4DG307200
rosa_wichuraiana	Rw4G026330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	426
AccB7I	CCANNNNNTGG	1 cut(s)	103
AciI	CCGC	1 cut(s)	196
AclWI	GGATC	3 cut(s)	88, 177, 375
AcsI	RAATTY	1 cut(s)	292
AfiI	CCNNNNNNNGG	1 cut(s)	103
AgsI	TTSAA	3 cut(s)	42, 133, 479
AluBI	AGCT	4 cut(s)	50, 193, 235, 394
AluI	AGCT	4 cut(s)	50, 193, 235, 394
Alw21I	GWGCWC	2 cut(s)	26, 148
AlwI	GGATC	3 cut(s)	88, 177, 375
AoxI	GGCC	1 cut(s)	135
ApeKI	GCWGC	3 cut(s)	193, 308, 394
ApoI	RAATTY	1 cut(s)	292
AspLEI	GCGC	2 cut(s)	181, 427
AspS9I	GGNCC	1 cut(s)	448
AsuHPI	GGTGA	1 cut(s)	80
AsuII	TTCGAA	1 cut(s)	296
AvaII	GGWCC	1 cut(s)	448
BauI	CACGAG	1 cut(s)	239
Bbv12I	GWGCWC	2 cut(s)	26, 148
BbvI	GCAGC	3 cut(s)	180, 295, 381
BfoI	RGCGCY	1 cut(s)	182
BglII	AGATCT	1 cut(s)	338
BisI	GCNGC	3 cut(s)	194, 309, 395
BlsI	GCNGC	3 cut(s)	195, 310, 396
Bme18I	GGWCC	1 cut(s)	448
BmgT120I	GGNCC	1 cut(s)	448
BplI	GAGNNNNNCTC	2 cut(s)	222, 254
Bpu14I	TTCGAA	1 cut(s)	296
BpuEI	CTTGAG	1 cut(s)	297
BsaJI	CCNNGG	1 cut(s)	111
Bsc4I	CCNNNNNNNGG	1 cut(s)	103
BseDI	CCNNGG	1 cut(s)	111
BseLI	CCNNNNNNNGG	1 cut(s)	103
BseXI	GCAGC	3 cut(s)	180, 295, 381
BshFI	GGCC	1 cut(s)	137
BsiHKAI	GWGCWC	2 cut(s)	26, 148
BslI	CCNNNNNNNGG	1 cut(s)	103
BsmI	GAATGC	1 cut(s)	304
BsnI	GGCC	1 cut(s)	137
Bsp119I	TTCGAA	1 cut(s)	296
Bsp1286I	GDGCHC	2 cut(s)	26, 148
Bsp143I	GATC	5 cut(s)	93, 169, 338, 354, 367
BspACI	CCGC	1 cut(s)	196
BspANI	GGCC	1 cut(s)	137
BspHI	TCATGA	1 cut(s)	379
BspPI	GGATC	3 cut(s)	88, 177, 375
BspT104I	TTCGAA	1 cut(s)	296
BssECI	CCNNGG	1 cut(s)	111
BssMI	GATC	5 cut(s)	93, 169, 338, 354, 367
BssSI	CACGAG	1 cut(s)	239
Bst2BI	CACGAG	1 cut(s)	239
Bst4CI	ACNGT	1 cut(s)	404
BstBI	TTCGAA	1 cut(s)	296
BstDEI	CTNAG	1 cut(s)	189
BstH2I	RGCGCY	1 cut(s)	182
BstHHI	GCGC	2 cut(s)	181, 427
BstKTI	GATC	6 cut(s)	96, 172, 341, 357, 370, 490
BstMBI	GATC	5 cut(s)	93, 169, 338, 354, 367
BstMWI	GCNNNNNNNGC	3 cut(s)	122, 143, 308
BstV1I	GCAGC	3 cut(s)	180, 295, 381
BstX2I	RGATCY	1 cut(s)	338
BstYI	RGATCY	1 cut(s)	338
BsuRI	GGCC	1 cut(s)	137
CciI	TCATGA	1 cut(s)	379
CfoI	GCGC	2 cut(s)	181, 427
Cfr13I	GGNCC	1 cut(s)	448
CviAII	CATG	3 cut(s)	122, 227, 380
CviJI	RGCY	8 cut(s)	50, 110, 116, 137, 193, 235, 394, 470
CviKI_1	RGCY	8 cut(s)	50, 110, 116, 137, 193, 235, 394, 470
DdeI	CTNAG	1 cut(s)	189
DpnI	GATC	6 cut(s)	95, 171, 340, 356, 369, 489
DpnII	GATC	5 cut(s)	93, 169, 338, 354, 367
Eco147I	AGGCCT	1 cut(s)	137
Eco32I	GATATC	1 cut(s)	412
Eco47I	GGWCC	1 cut(s)	448
EcoRV	GATATC	1 cut(s)	412
FaeI	CATG	3 cut(s)	125, 230, 383
FaiI	YATR	6 cut(s)	87, 102, 104, 123, 228, 381
FatI	CATG	3 cut(s)	121, 226, 379
FauNDI	CATATG	1 cut(s)	102
Fnu4HI	GCNGC	3 cut(s)	194, 309, 395
Fsp4HI	GCNGC	3 cut(s)	194, 309, 395
FspI	TGCGCA	1 cut(s)	426
GlaI	GCGC	2 cut(s)	180, 426
GluI	GCNGC	3 cut(s)	194, 309, 395
HaeII	RGCGCY	1 cut(s)	182
HaeIII	GGCC	1 cut(s)	137
HhaI	GCGC	2 cut(s)	181, 427
Hin1II	CATG	3 cut(s)	125, 230, 383
Hin6I	GCGC	2 cut(s)	179, 425
HinP1I	GCGC	2 cut(s)	179, 425
HinfI	GANTC	2 cut(s)	57, 263
HphI	GGTGA	1 cut(s)	80
Hpy188I	TCNGA	4 cut(s)	62, 154, 259, 354
Hpy188III	TCNNGA	6 cut(s)	42, 130, 241, 314, 380, 407
Hpy99I	CGWCG	1 cut(s)	263
HpyAV	CCTTC	5 cut(s)	48, 57, 127, 193, 461
HpyCH4III	ACNGT	1 cut(s)	404
HpyCH4V	TGCA	1 cut(s)	35
HpyF10VI	GCNNNNNNNGC	3 cut(s)	122, 143, 308
HpyF3I	CTNAG	1 cut(s)	189
Hsp92II	CATG	3 cut(s)	125, 230, 383
HspAI	GCGC	2 cut(s)	179, 425
Kzo9I	GATC	5 cut(s)	93, 169, 338, 354, 367
LpnPI	CCDG	4 cut(s)	12, 256, 327, 435
Lsp1109I	GCAGC	3 cut(s)	180, 295, 381
MalI	GATC	6 cut(s)	95, 171, 340, 356, 369, 489
MboI	GATC	5 cut(s)	93, 169, 338, 354, 367
MboII	GAAGA	1 cut(s)	256
MfeI	CAATTG	1 cut(s)	428
MflI	RGATCY	1 cut(s)	338
MhlI	GDGCHC	2 cut(s)	26, 148
MluCI	AATT	2 cut(s)	292, 428
MlyI	GAGTC	2 cut(s)	66, 272
MmeI	TCCRAC	1 cut(s)	282
MnlI	CCTC	3 cut(s)	106, 376, 425
MseI	TTAA	2 cut(s)	207, 278
MunI	CAATTG	1 cut(s)	428
Mva1269I	GAATGC	1 cut(s)	304
MwoI	GCNNNNNNNGC	3 cut(s)	122, 143, 308
NdeI	CATATG	1 cut(s)	102
NdeII	GATC	5 cut(s)	93, 169, 338, 354, 367
NlaIII	CATG	3 cut(s)	125, 230, 383
NmeAIII	GCCGAG	1 cut(s)	136
NsbI	TGCGCA	1 cut(s)	426
NspV	TTCGAA	1 cut(s)	296
PagI	TCATGA	1 cut(s)	379
PceI	AGGCCT	1 cut(s)	137
PcsI	WCGNNNNNNNCGW	1 cut(s)	58
PctI	GAATGC	1 cut(s)	304
PflMI	CCANNNNNTGG	1 cut(s)	103
PkrI	GCNGC	3 cut(s)	195, 310, 396
PleI	GAGTC	2 cut(s)	65, 271
PpsI	GAGTC	2 cut(s)	65, 271
PspPI	GGNCC	1 cut(s)	448
PsuI	RGATCY	1 cut(s)	338
SaqAI	TTAA	2 cut(s)	207, 278
SatI	GCNGC	3 cut(s)	194, 309, 395
Sau3AI	GATC	5 cut(s)	93, 169, 338, 354, 367
Sau96I	GGNCC	1 cut(s)	448
SchI	GAGTC	2 cut(s)	66, 272
SduI	GDGCHC	2 cut(s)	26, 148
SetI	ASST	7 cut(s)	10, 40, 52, 195, 237, 387, 396
SfuI	TTCGAA	1 cut(s)	296
SinI	GGWCC	1 cut(s)	448
SmlI	CTYRAG	1 cut(s)	312
SmoI	CTYRAG	1 cut(s)	312
Sse9I	AATT	2 cut(s)	292, 428
SseBI	AGGCCT	1 cut(s)	137
SsiI	CCGC	1 cut(s)	196
StuI	AGGCCT	1 cut(s)	137
TaaI	ACNGT	1 cut(s)	404
TaqI	TCGA	3 cut(s)	81, 296, 454
TasI	AATT	2 cut(s)	292, 428
Tru1I	TTAA	2 cut(s)	207, 278
Tru9I	TTAA	2 cut(s)	207, 278
TseI	GCWGC	3 cut(s)	193, 308, 394
TspDTI	ATGAA	2 cut(s)	237, 368
TspGWI	ACGGA	1 cut(s)	380
Van91I	CCANNNNNTGG	1 cut(s)	103
VpaK11BI	GGWCC	1 cut(s)	448
XapI	RAATTY	1 cut(s)	292

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.