Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006263.1

Orthogroup ID

OG0005915

Physical Location & Seq

Genomic Coordinates Reverse (-)

65020 .. 66851

Gene Structure 1832 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006263.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 759 bp

atgatgatgaagatcagaaatgatggcacagatgtcaaagcttcctacttcatcagtccgatgatacagaagagatgggaatgggacccttttctgagtgtgaaactgcaagtcaccgatgatggccgtctctgtttgcagaagacttatggcaactcctcattggtgccttcttcccacttaaatagtccgatgataccggagagtgggaaactggttggtcaaatccaagacgagatgcgaggtcgcaaacgcaagtgctctggtgttgcaccttcaagagaagctcgtagagtccgaaggggtgaaaagaaaatcgactatgagatgatccaccatatggaagccgaggcttaccatgctgtcttgaaggcctttagtgctcaatctgatagtatctcttgggatcgggtggcgctgatgactaagctgcggaaggaacttaacattacagatgatgaacatggagagctactcgtgaagattaggcaatcggacgagtctatcagggcgttaagggaatggcgaaattcgaatgctactgctgctcaagagtttggtaatgtcgctaaaagatctggttttattcagatcggtgctacggatcaaatcattcatgaggttgagaagctgcttgacagtcaagatatcctctcccctgcgcaattggaacgggcaaacttggtccttcgacagcacgaaagggctatccttgaagcacttgatcagctggctatagatgaagctgctggtgactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ENT

Protein Analysis

252

Amino Acids

28.64

Weight (kDa)

6.68

Isoelectric Point (pI)

46.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005915)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g24150 FvH4_4g24150 FvH4_4g24150 FvH4_4g24150 FvH4_6g03210
malus_domestica	MD14G1008100.v1.1
prunus_persica	Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1
pyrus_communis	pycom14g00640
rosa_chinensis	RchiOBHm_Chr4g0430921
rosa_laevigata	RLG00000006938
rosa_multiflora	Rmu_co8131438.1_g000001 Rmu_sc0006263.1_g000012 Rmu_sc0041372.1_g000001
rosa_roxburghii	Rroxscaffold_5G00372610
rosa_samantha	Rh4AG302900 Rh4AG303800 Rh4BG311100 Rh4CG327400 Rh4DG307200
rosa_wichuraiana	Rw4G026330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	663
AccB1I	GGYRCC	1 cut(s)	166
AccB7I	CCANNNNNTGG	1 cut(s)	340
AciI	CCGC	1 cut(s)	433
AclWI	GGATC	3 cut(s)	325, 414, 612
AcoI	YGGCCR	1 cut(s)	124
AcsI	RAATTY	1 cut(s)	529
AfiI	CCNNNNNNNGG	2 cut(s)	206, 340
AgsI	TTSAA	3 cut(s)	279, 370, 716
AluBI	AGCT	7 cut(s)	41, 287, 430, 472, 631, 730, 746
AluI	AGCT	7 cut(s)	41, 287, 430, 472, 631, 730, 746
Alw21I	GWGCWC	2 cut(s)	263, 385
Alw26I	GTCTC	1 cut(s)	134
AlwI	GGATC	3 cut(s)	325, 414, 612
AoxI	GGCC	2 cut(s)	124, 372
ApeKI	GCWGC	4 cut(s)	430, 545, 631, 746
ApoI	RAATTY	1 cut(s)	529
AspLEI	GCGC	2 cut(s)	418, 664
AspS9I	GGNCC	2 cut(s)	85, 685
AsuHPI	GGTGA	2 cut(s)	106, 317
AsuII	TTCGAA	1 cut(s)	533
AvaII	GGWCC	2 cut(s)	85, 685
BanI	GGYRCC	1 cut(s)	166
BauI	CACGAG	1 cut(s)	476
BbsI	GAAGAC	1 cut(s)	149
Bbv12I	GWGCWC	2 cut(s)	263, 385
BbvI	GCAGC	4 cut(s)	417, 532, 618, 733
BccI	CCATC	3 cut(s)	17, 69, 116
BceAI	ACGGC	1 cut(s)	111
BclI	TGATCA	1 cut(s)	724
BcoDI	GTCTC	1 cut(s)	134
BfmI	CTRYAG	1 cut(s)	735
BfoI	RGCGCY	1 cut(s)	419
BglII	AGATCT	1 cut(s)	575
BisI	GCNGC	4 cut(s)	431, 546, 632, 747
BlsI	GCNGC	4 cut(s)	432, 547, 633, 748
Bme18I	GGWCC	2 cut(s)	85, 685
BmgT120I	GGNCC	2 cut(s)	85, 685
BmiI	GGNNCC	3 cut(s)	86, 87, 168
BmsI	GCATC	1 cut(s)	228
BpiI	GAAGAC	1 cut(s)	149
BplI	GAGNNNNNCTC	2 cut(s)	459, 491
Bpu14I	TTCGAA	1 cut(s)	533
BpuEI	CTTGAG	1 cut(s)	534
BsaBI	GATNNNNATC	1 cut(s)	11
BsaJI	CCNNGG	1 cut(s)	348
BsaWI	WCCGGW	1 cut(s)	199
Bsc4I	CCNNNNNNNGG	2 cut(s)	206, 340
Bse1I	ACTGG	1 cut(s)	219
Bse8I	GATNNNNATC	1 cut(s)	11
BseDI	CCNNGG	1 cut(s)	348
BseJI	GATNNNNATC	1 cut(s)	11
BseLI	CCNNNNNNNGG	2 cut(s)	206, 340
BseMII	CTCAG	1 cut(s)	86
BseNI	ACTGG	1 cut(s)	219
BseRI	GAGGAG	1 cut(s)	148
BseXI	GCAGC	4 cut(s)	417, 532, 618, 733
BshFI	GGCC	2 cut(s)	126, 374
BshNI	GGYRCC	1 cut(s)	166
BsiHKAI	GWGCWC	2 cut(s)	263, 385
BsiSI	CCGG	1 cut(s)	200
BslFI	GGGAC	1 cut(s)	98
BslI	CCNNNNNNNGG	2 cut(s)	206, 340
BsmAI	GTCTC	1 cut(s)	134
BsmBI	CGTCTC	1 cut(s)	134
BsmFI	GGGAC	1 cut(s)	98
BsmI	GAATGC	1 cut(s)	541
BsnI	GGCC	2 cut(s)	126, 374
Bsp119I	TTCGAA	1 cut(s)	533
Bsp1286I	GDGCHC	2 cut(s)	263, 385
Bsp143I	GATC	7 cut(s)	12, 330, 406, 575, 591, 604, 724
BspACI	CCGC	1 cut(s)	433
BspANI	GGCC	2 cut(s)	126, 374
BspCNI	CTCAG	1 cut(s)	87
BspHI	TCATGA	1 cut(s)	616
BspLI	GGNNCC	3 cut(s)	86, 87, 168
BspPI	GGATC	3 cut(s)	325, 414, 612
BspT104I	TTCGAA	1 cut(s)	533
BspT107I	GGYRCC	1 cut(s)	166
BsrI	ACTGG	1 cut(s)	219
BssECI	CCNNGG	1 cut(s)	348
BssMI	GATC	7 cut(s)	12, 330, 406, 575, 591, 604, 724
BssSI	CACGAG	1 cut(s)	476
Bst2BI	CACGAG	1 cut(s)	476
Bst4CI	ACNGT	1 cut(s)	641
Bst6I	CTCTTC	1 cut(s)	65
BstBI	TTCGAA	1 cut(s)	533
BstC8I	GCNNGC	1 cut(s)	732
BstDEI	CTNAG	2 cut(s)	95, 426
BstH2I	RGCGCY	1 cut(s)	419
BstHHI	GCGC	2 cut(s)	418, 664
BstKTI	GATC	7 cut(s)	15, 333, 409, 578, 594, 607, 727
BstMAI	GTCTC	1 cut(s)	134
BstMBI	GATC	7 cut(s)	12, 330, 406, 575, 591, 604, 724
BstMWI	GCNNNNNNNGC	3 cut(s)	359, 380, 545
BstSFI	CTRYAG	1 cut(s)	735
BstV1I	GCAGC	4 cut(s)	417, 532, 618, 733
BstV2I	GAAGAC	1 cut(s)	149
BstX2I	RGATCY	1 cut(s)	575
BstYI	RGATCY	1 cut(s)	575
BsuRI	GGCC	2 cut(s)	126, 374
Cac8I	GCNNGC	1 cut(s)	732
CciI	TCATGA	1 cut(s)	616
CfoI	GCGC	2 cut(s)	418, 664
Cfr13I	GGNCC	2 cut(s)	85, 685
CviAII	CATG	3 cut(s)	359, 464, 617
DdeI	CTNAG	2 cut(s)	95, 426
DpnI	GATC	7 cut(s)	14, 332, 408, 577, 593, 606, 726
DpnII	GATC	7 cut(s)	12, 330, 406, 575, 591, 604, 724
EaeI	YGGCCR	1 cut(s)	124
Eam1104I	CTCTTC	1 cut(s)	65
EarI	CTCTTC	1 cut(s)	65
Eco147I	AGGCCT	1 cut(s)	374
Eco32I	GATATC	1 cut(s)	649
Eco47I	GGWCC	2 cut(s)	85, 685
EcoO109I	RGGNCCY	1 cut(s)	85
EcoRV	GATATC	1 cut(s)	649
Esp3I	CGTCTC	1 cut(s)	134
FaeI	CATG	3 cut(s)	362, 467, 620
FaiI	YATR	8 cut(s)	150, 324, 339, 341, 360, 465, 618, 737
FaqI	GGGAC	1 cut(s)	98
FatI	CATG	3 cut(s)	358, 463, 616
FauNDI	CATATG	1 cut(s)	339
FbaI	TGATCA	1 cut(s)	724
Fnu4HI	GCNGC	4 cut(s)	431, 546, 632, 747
Fsp4HI	GCNGC	4 cut(s)	431, 546, 632, 747
FspI	TGCGCA	1 cut(s)	663
GlaI	GCGC	2 cut(s)	417, 663
GluI	GCNGC	4 cut(s)	431, 546, 632, 747
HaeII	RGCGCY	1 cut(s)	419
HaeIII	GGCC	2 cut(s)	126, 374
HapII	CCGG	1 cut(s)	200
HhaI	GCGC	2 cut(s)	418, 664
Hin1II	CATG	3 cut(s)	362, 467, 620
Hin6I	GCGC	2 cut(s)	416, 662
HinP1I	GCGC	2 cut(s)	416, 662
HindIII	AAGCTT	1 cut(s)	39
HinfI	GANTC	2 cut(s)	294, 500
HpaII	CCGG	1 cut(s)	200
HphI	GGTGA	2 cut(s)	106, 317
Hpy188I	TCNGA	8 cut(s)	17, 60, 96, 192, 299, 391, 496, 591
Hpy188III	TCNNGA	6 cut(s)	279, 367, 478, 551, 617, 644
HpyAV	CCTTC	6 cut(s)	180, 285, 294, 364, 430, 698
HpyCH4III	ACNGT	1 cut(s)	641
HpyCH4V	TGCA	3 cut(s)	109, 139, 272
HpyF10VI	GCNNNNNNNGC	3 cut(s)	359, 380, 545
HpyF3I	CTNAG	2 cut(s)	95, 426
Hsp92II	CATG	3 cut(s)	362, 467, 620
HspAI	GCGC	2 cut(s)	416, 662
KflI	GGGWCCC	1 cut(s)	85
Ksp22I	TGATCA	1 cut(s)	724
Kzo9I	GATC	7 cut(s)	12, 330, 406, 575, 591, 604, 724
LpnPI	CCDG	8 cut(s)	200, 213, 249, 493, 564, 672, 716, 735
Lsp1109I	GCAGC	4 cut(s)	417, 532, 618, 733
LweI	GCATC	1 cut(s)	228
MaeIII	GTNAC	2 cut(s)	112, 752
MalI	GATC	7 cut(s)	14, 332, 408, 577, 593, 606, 726
MboI	GATC	7 cut(s)	12, 330, 406, 575, 591, 604, 724
MboII	GAAGA	5 cut(s)	22, 82, 154, 165, 493
MfeI	CAATTG	1 cut(s)	665
MflI	RGATCY	1 cut(s)	575
MhlI	GDGCHC	2 cut(s)	263, 385
MluCI	AATT	2 cut(s)	529, 665
MlyI	GAGTC	2 cut(s)	303, 509
MnlI	CCTC	5 cut(s)	169, 236, 343, 613, 662
MseI	TTAA	3 cut(s)	182, 444, 515
MspA1I	CMGCKG	1 cut(s)	730
MspI	CCGG	1 cut(s)	200
MunI	CAATTG	1 cut(s)	665
Mva1269I	GAATGC	1 cut(s)	541
MwoI	GCNNNNNNNGC	3 cut(s)	359, 380, 545
NdeI	CATATG	1 cut(s)	339
NdeII	GATC	7 cut(s)	12, 330, 406, 575, 591, 604, 724
NlaIII	CATG	3 cut(s)	362, 467, 620
NlaIV	GGNNCC	3 cut(s)	86, 87, 168
NmeAIII	GCCGAG	1 cut(s)	373
NmuCI	GTSAC	2 cut(s)	112, 752
NsbI	TGCGCA	1 cut(s)	663
NspV	TTCGAA	1 cut(s)	533
PagI	TCATGA	1 cut(s)	616
PceI	AGGCCT	1 cut(s)	374
PcsI	WCGNNNNNNNCGW	1 cut(s)	295
PctI	GAATGC	1 cut(s)	541
PflMI	CCANNNNNTGG	1 cut(s)	340
PkrI	GCNGC	4 cut(s)	432, 547, 633, 748
PleI	GAGTC	2 cut(s)	302, 508
PpsI	GAGTC	2 cut(s)	302, 508
PpuMI	RGGWCCY	1 cut(s)	85
Psp5II	RGGWCCY	1 cut(s)	85
PspN4I	GGNNCC	3 cut(s)	86, 87, 168
PspPI	GGNCC	2 cut(s)	85, 685
PspPPI	RGGWCCY	1 cut(s)	85
PsuI	RGATCY	1 cut(s)	575
PvuII	CAGCTG	1 cut(s)	730
SaqAI	TTAA	3 cut(s)	182, 444, 515
SatI	GCNGC	4 cut(s)	431, 546, 632, 747
Sau3AI	GATC	7 cut(s)	12, 330, 406, 575, 591, 604, 724
Sau96I	GGNCC	2 cut(s)	85, 685
SchI	GAGTC	2 cut(s)	303, 509
SduI	GDGCHC	2 cut(s)	263, 385
SfaNI	GCATC	1 cut(s)	228
SfcI	CTRYAG	1 cut(s)	735
SfuI	TTCGAA	1 cut(s)	533
SinI	GGWCC	2 cut(s)	85, 685
SmlI	CTYRAG	1 cut(s)	549
SmoI	CTYRAG	1 cut(s)	549
Sse9I	AATT	2 cut(s)	529, 665
SseBI	AGGCCT	1 cut(s)	374
SsiI	CCGC	1 cut(s)	433
StuI	AGGCCT	1 cut(s)	374
TaaI	ACNGT	1 cut(s)	641
TaqI	TCGA	3 cut(s)	318, 533, 691
TasI	AATT	2 cut(s)	529, 665
Tru1I	TTAA	3 cut(s)	182, 444, 515
Tru9I	TTAA	3 cut(s)	182, 444, 515
TseFI	GTSAC	2 cut(s)	112, 752
TseI	GCWGC	4 cut(s)	430, 545, 631, 746
Tsp45I	GTSAC	2 cut(s)	112, 752
TspDTI	ATGAA	5 cut(s)	23, 40, 474, 605, 756
TspGWI	ACGGA	1 cut(s)	617
Van91I	CCANNNNNTGG	1 cut(s)	340
VpaK11BI	GGWCC	2 cut(s)	85, 685
XapI	RAATTY	1 cut(s)	529

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.