Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041372.1

Orthogroup ID

OG0005915

Physical Location & Seq

Genomic Coordinates Reverse (-)

731 .. 2294

Gene Structure 1564 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041372.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 774 bp

atgaagatcagaaatgatggcacagatgtcaaagcttcctacttcatcagtccgatgatacagaagagatgggaatgggacccttttctgagtgtgaaactgcaagtcaccgatggtggccgtctctgtttgcagaagacttatggcaactcctcattggtgccttcttcccacttaaatagtccgatgataccggagagtgggaaactggttggtcaaatccaagacgagatgcgaggtcgcaaacgcaagtgctctggtgttgcaccttcaagagaagctcgtagagtccgaaggggtgaaaggaaaatcgactatgagatgatccaccatatggaagccgaggcttaccatgctgtcttgaaggcctttagtgctcaatctgatagtatctcttgggatcgggtggcgctgatgactaagctgcggaaggaacttaacattacagatgatgaacatggagagctactcgtgaagattaggcaatccgacgagtctatcagggcgttaagggaatggcgaaattcgaatgctactgctgctcaagagtttggtaatgtcgctaaaagatctggttttattcagatcggtgctacggatcaaatcattcatgaggttgagaagctgcttgacagtcaagatatcctctcccctgcgcaattggaacgggcaaacttggtccttcgacagcacgaaagggctatccttgaagcacttgatcaactggctatagatgaagctgctggagattacatggtcgatgtaaagttgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ENT

Protein Analysis

257

Amino Acids

29.2

Weight (kDa)

7.07

Isoelectric Point (pI)

47.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005915)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g24150 FvH4_4g24150 FvH4_4g24150 FvH4_4g24150 FvH4_6g03210
malus_domestica	MD14G1008100.v1.1
prunus_persica	Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1 Prupe.7G014800_v2.0.a1
pyrus_communis	pycom14g00640
rosa_chinensis	RchiOBHm_Chr4g0430921
rosa_laevigata	RLG00000006938
rosa_multiflora	Rmu_co8131438.1_g000001 Rmu_sc0006263.1_g000012 Rmu_sc0041372.1_g000001
rosa_roxburghii	Rroxscaffold_5G00372610
rosa_samantha	Rh4AG302900 Rh4AG303800 Rh4BG311100 Rh4CG327400 Rh4DG307200
rosa_wichuraiana	Rw4G026330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	657
AccB1I	GGYRCC	1 cut(s)	160
AccB7I	CCANNNNNTGG	1 cut(s)	334
AciI	CCGC	1 cut(s)	427
AclWI	GGATC	3 cut(s)	319, 408, 606
AcoI	YGGCCR	1 cut(s)	118
AcsI	RAATTY	1 cut(s)	523
AfiI	CCNNNNNNNGG	2 cut(s)	200, 334
AgsI	TTSAA	3 cut(s)	273, 364, 710
AluBI	AGCT	6 cut(s)	35, 281, 424, 466, 625, 740
AluI	AGCT	6 cut(s)	35, 281, 424, 466, 625, 740
Alw21I	GWGCWC	2 cut(s)	257, 379
Alw26I	GTCTC	1 cut(s)	128
AlwI	GGATC	3 cut(s)	319, 408, 606
AoxI	GGCC	2 cut(s)	118, 366
ApeKI	GCWGC	4 cut(s)	424, 539, 625, 740
ApoI	RAATTY	1 cut(s)	523
AspLEI	GCGC	2 cut(s)	412, 658
AspS9I	GGNCC	2 cut(s)	79, 679
AsuHPI	GGTGA	2 cut(s)	100, 311
AsuII	TTCGAA	1 cut(s)	527
AvaII	GGWCC	2 cut(s)	79, 679
BanI	GGYRCC	1 cut(s)	160
BauI	CACGAG	1 cut(s)	470
BbsI	GAAGAC	1 cut(s)	143
Bbv12I	GWGCWC	2 cut(s)	257, 379
BbvI	GCAGC	4 cut(s)	411, 526, 612, 727
BccI	CCATC	3 cut(s)	11, 63, 107
BceAI	ACGGC	1 cut(s)	105
BclI	TGATCA	1 cut(s)	718
BcoDI	GTCTC	1 cut(s)	128
BfmI	CTRYAG	1 cut(s)	729
BfoI	RGCGCY	1 cut(s)	413
BglII	AGATCT	1 cut(s)	569
BisI	GCNGC	4 cut(s)	425, 540, 626, 741
BlsI	GCNGC	4 cut(s)	426, 541, 627, 742
Bme18I	GGWCC	2 cut(s)	79, 679
BmgT120I	GGNCC	2 cut(s)	79, 679
BmiI	GGNNCC	3 cut(s)	80, 81, 162
BmsI	GCATC	1 cut(s)	222
BpiI	GAAGAC	1 cut(s)	143
BplI	GAGNNNNNCTC	2 cut(s)	453, 485
BpmI	CTGGAG	1 cut(s)	765
Bpu14I	TTCGAA	1 cut(s)	527
BpuEI	CTTGAG	1 cut(s)	528
BsaJI	CCNNGG	1 cut(s)	342
BsaWI	WCCGGW	1 cut(s)	193
Bsc4I	CCNNNNNNNGG	2 cut(s)	200, 334
Bse1I	ACTGG	2 cut(s)	213, 729
BseDI	CCNNGG	1 cut(s)	342
BseLI	CCNNNNNNNGG	2 cut(s)	200, 334
BseMII	CTCAG	1 cut(s)	80
BseNI	ACTGG	2 cut(s)	213, 729
BseRI	GAGGAG	1 cut(s)	142
BseXI	GCAGC	4 cut(s)	411, 526, 612, 727
BshFI	GGCC	2 cut(s)	120, 368
BshNI	GGYRCC	1 cut(s)	160
BsiHKAI	GWGCWC	2 cut(s)	257, 379
BsiSI	CCGG	1 cut(s)	194
BslFI	GGGAC	1 cut(s)	92
BslI	CCNNNNNNNGG	2 cut(s)	200, 334
BsmAI	GTCTC	1 cut(s)	128
BsmBI	CGTCTC	1 cut(s)	128
BsmFI	GGGAC	1 cut(s)	92
BsmI	GAATGC	1 cut(s)	535
BsnI	GGCC	2 cut(s)	120, 368
Bsp119I	TTCGAA	1 cut(s)	527
Bsp1286I	GDGCHC	2 cut(s)	257, 379
Bsp143I	GATC	7 cut(s)	6, 324, 400, 569, 585, 598, 718
BspACI	CCGC	1 cut(s)	427
BspANI	GGCC	2 cut(s)	120, 368
BspCNI	CTCAG	1 cut(s)	81
BspHI	TCATGA	1 cut(s)	610
BspLI	GGNNCC	3 cut(s)	80, 81, 162
BspPI	GGATC	3 cut(s)	319, 408, 606
BspT104I	TTCGAA	1 cut(s)	527
BspT107I	GGYRCC	1 cut(s)	160
BsrI	ACTGG	2 cut(s)	213, 729
BssECI	CCNNGG	1 cut(s)	342
BssMI	GATC	7 cut(s)	6, 324, 400, 569, 585, 598, 718
BssSI	CACGAG	1 cut(s)	470
Bst2BI	CACGAG	1 cut(s)	470
Bst4CI	ACNGT	1 cut(s)	635
Bst6I	CTCTTC	1 cut(s)	59
BstBI	TTCGAA	1 cut(s)	527
BstDEI	CTNAG	2 cut(s)	89, 420
BstH2I	RGCGCY	1 cut(s)	413
BstHHI	GCGC	2 cut(s)	412, 658
BstKTI	GATC	7 cut(s)	9, 327, 403, 572, 588, 601, 721
BstMAI	GTCTC	1 cut(s)	128
BstMBI	GATC	7 cut(s)	6, 324, 400, 569, 585, 598, 718
BstMWI	GCNNNNNNNGC	3 cut(s)	353, 374, 539
BstSFI	CTRYAG	1 cut(s)	729
BstV1I	GCAGC	4 cut(s)	411, 526, 612, 727
BstV2I	GAAGAC	1 cut(s)	143
BstX2I	RGATCY	1 cut(s)	569
BstYI	RGATCY	1 cut(s)	569
BsuRI	GGCC	2 cut(s)	120, 368
CciI	TCATGA	1 cut(s)	610
CfoI	GCGC	2 cut(s)	412, 658
Cfr13I	GGNCC	2 cut(s)	79, 679
CviAII	CATG	4 cut(s)	353, 458, 611, 754
DdeI	CTNAG	2 cut(s)	89, 420
DpnI	GATC	7 cut(s)	8, 326, 402, 571, 587, 600, 720
DpnII	GATC	7 cut(s)	6, 324, 400, 569, 585, 598, 718
EaeI	YGGCCR	1 cut(s)	118
Eam1104I	CTCTTC	1 cut(s)	59
EarI	CTCTTC	1 cut(s)	59
Eco147I	AGGCCT	1 cut(s)	368
Eco32I	GATATC	1 cut(s)	643
Eco47I	GGWCC	2 cut(s)	79, 679
EcoO109I	RGGNCCY	1 cut(s)	79
EcoRV	GATATC	1 cut(s)	643
Esp3I	CGTCTC	1 cut(s)	128
FaeI	CATG	4 cut(s)	356, 461, 614, 757
FaiI	YATR	9 cut(s)	144, 318, 333, 335, 354, 459, 612, 731, 755
FaqI	GGGAC	1 cut(s)	92
FatI	CATG	4 cut(s)	352, 457, 610, 753
FauNDI	CATATG	1 cut(s)	333
FbaI	TGATCA	1 cut(s)	718
Fnu4HI	GCNGC	4 cut(s)	425, 540, 626, 741
Fsp4HI	GCNGC	4 cut(s)	425, 540, 626, 741
FspI	TGCGCA	1 cut(s)	657
GlaI	GCGC	2 cut(s)	411, 657
GluI	GCNGC	4 cut(s)	425, 540, 626, 741
GsuI	CTGGAG	1 cut(s)	765
HaeII	RGCGCY	1 cut(s)	413
HaeIII	GGCC	2 cut(s)	120, 368
HapII	CCGG	1 cut(s)	194
HhaI	GCGC	2 cut(s)	412, 658
Hin1II	CATG	4 cut(s)	356, 461, 614, 757
Hin6I	GCGC	2 cut(s)	410, 656
HinP1I	GCGC	2 cut(s)	410, 656
HindIII	AAGCTT	1 cut(s)	33
HinfI	GANTC	2 cut(s)	288, 494
HpaII	CCGG	1 cut(s)	194
HphI	GGTGA	2 cut(s)	100, 311
Hpy188I	TCNGA	8 cut(s)	11, 54, 90, 186, 293, 385, 490, 585
Hpy188III	TCNNGA	6 cut(s)	273, 361, 472, 545, 611, 638
Hpy99I	CGWCG	1 cut(s)	494
HpyAV	CCTTC	6 cut(s)	174, 279, 288, 358, 424, 692
HpyCH4III	ACNGT	1 cut(s)	635
HpyCH4V	TGCA	3 cut(s)	103, 133, 266
HpyF10VI	GCNNNNNNNGC	3 cut(s)	353, 374, 539
HpyF3I	CTNAG	2 cut(s)	89, 420
Hsp92II	CATG	4 cut(s)	356, 461, 614, 757
HspAI	GCGC	2 cut(s)	410, 656
KflI	GGGWCCC	1 cut(s)	79
Ksp22I	TGATCA	1 cut(s)	718
Kzo9I	GATC	7 cut(s)	6, 324, 400, 569, 585, 598, 718
LpnPI	CCDG	8 cut(s)	194, 207, 243, 487, 558, 666, 710, 729
Lsp1109I	GCAGC	4 cut(s)	411, 526, 612, 727
LweI	GCATC	1 cut(s)	222
MaeIII	GTNAC	1 cut(s)	106
MalI	GATC	7 cut(s)	8, 326, 402, 571, 587, 600, 720
MboI	GATC	7 cut(s)	6, 324, 400, 569, 585, 598, 718
MboII	GAAGA	5 cut(s)	16, 76, 148, 159, 487
MfeI	CAATTG	1 cut(s)	659
MflI	RGATCY	1 cut(s)	569
MhlI	GDGCHC	2 cut(s)	257, 379
MluCI	AATT	2 cut(s)	523, 659
MlyI	GAGTC	2 cut(s)	297, 503
MmeI	TCCRAC	1 cut(s)	513
MnlI	CCTC	5 cut(s)	163, 230, 337, 607, 656
MseI	TTAA	3 cut(s)	176, 438, 509
MspI	CCGG	1 cut(s)	194
MunI	CAATTG	1 cut(s)	659
Mva1269I	GAATGC	1 cut(s)	535
MwoI	GCNNNNNNNGC	3 cut(s)	353, 374, 539
NdeI	CATATG	1 cut(s)	333
NdeII	GATC	7 cut(s)	6, 324, 400, 569, 585, 598, 718
NlaIII	CATG	4 cut(s)	356, 461, 614, 757
NlaIV	GGNNCC	3 cut(s)	80, 81, 162
NmeAIII	GCCGAG	1 cut(s)	367
NmuCI	GTSAC	1 cut(s)	106
NsbI	TGCGCA	1 cut(s)	657
NspV	TTCGAA	1 cut(s)	527
PagI	TCATGA	1 cut(s)	610
PceI	AGGCCT	1 cut(s)	368
PcsI	WCGNNNNNNNCGW	1 cut(s)	289
PctI	GAATGC	1 cut(s)	535
PflMI	CCANNNNNTGG	1 cut(s)	334
PkrI	GCNGC	4 cut(s)	426, 541, 627, 742
PleI	GAGTC	2 cut(s)	296, 502
PpsI	GAGTC	2 cut(s)	296, 502
PpuMI	RGGWCCY	1 cut(s)	79
Psp5II	RGGWCCY	1 cut(s)	79
PspN4I	GGNNCC	3 cut(s)	80, 81, 162
PspPI	GGNCC	2 cut(s)	79, 679
PspPPI	RGGWCCY	1 cut(s)	79
PsuI	RGATCY	1 cut(s)	569
SaqAI	TTAA	3 cut(s)	176, 438, 509
SatI	GCNGC	4 cut(s)	425, 540, 626, 741
Sau3AI	GATC	7 cut(s)	6, 324, 400, 569, 585, 598, 718
Sau96I	GGNCC	2 cut(s)	79, 679
SchI	GAGTC	2 cut(s)	297, 503
SduI	GDGCHC	2 cut(s)	257, 379
SetI	ASST	9 cut(s)	37, 241, 271, 283, 426, 468, 618, 627, 742
SfaNI	GCATC	1 cut(s)	222
SfcI	CTRYAG	1 cut(s)	729
SfuI	TTCGAA	1 cut(s)	527
SinI	GGWCC	2 cut(s)	79, 679
SmlI	CTYRAG	1 cut(s)	543
SmoI	CTYRAG	1 cut(s)	543
Sse9I	AATT	2 cut(s)	523, 659
SseBI	AGGCCT	1 cut(s)	368
SsiI	CCGC	1 cut(s)	427
StuI	AGGCCT	1 cut(s)	368
TaaI	ACNGT	1 cut(s)	635
TaqI	TCGA	4 cut(s)	312, 527, 685, 759
TasI	AATT	2 cut(s)	523, 659
Tru1I	TTAA	3 cut(s)	176, 438, 509
Tru9I	TTAA	3 cut(s)	176, 438, 509
TseFI	GTSAC	1 cut(s)	106
TseI	GCWGC	4 cut(s)	424, 539, 625, 740
Tsp45I	GTSAC	1 cut(s)	106
TspDTI	ATGAA	5 cut(s)	17, 34, 468, 599, 750
TspGWI	ACGGA	1 cut(s)	611
Van91I	CCANNNNNTGG	1 cut(s)	334
VpaK11BI	GGWCC	2 cut(s)	79, 679
XapI	RAATTY	1 cut(s)	523

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.