Rmu_co8134732.1_g000001

Regulator of Vps4 activity in the MVB pathway

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8134732.1
Physical Location & Seq
Forward (+)
1 .. 634
634 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8134732.1_g000001.1.cds

Sequence Viewer

Length: 634 bp
ataagaaggtccagacaccaccacacccactcgccggttcaagtggcacggctggatcagcagaagttttgcaggcttttaaagaagagacggaaaaagatgataagtattctcagaagaaatacaaggatgtggctcatgcagcccaggctgcttttgagtctgcagcttatgcagcagcagctgcaagagcagccgtggaactgtccagatccgaaactcatgattctgatgatcaaaacagtcctggtcctaaacgaggcaagttatctagcagatacgagtcctcaaaaactgaatttggatcacagaatgagcacatcactgttcagaatcaagctgaagaattgaagaggtcagcatcttcttcaagttcagattcaggaggtgacacactggaggtgactcctcagatgtcctccgatgccataggccaacccagtcattcaggcaaggtcacagtttttgatgatagtgacaatgaagaaagtaccatggccctatctccagagaaagttccttcaagggttcaatctggcatgaaggttgagccagagggatcatctagaaggctaacattaaacctggagaaaggaccattctctctgagaaacagatgggtccgtggccacta
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

210

Amino Acids

22.58

Weight (kDa)

5.91

Isoelectric Point (pI)

64.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012396)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 63, 206, 312, 567
AcoI YGGCCR 1 cut(s) 627
AcsI RAATTY 1 cut(s) 298
AcuI CTGAAG 1 cut(s) 362
AfaI GTAC 1 cut(s) 492
AfiI CCNNNNNNNGG 2 cut(s) 34, 259
AgsI TTSAA 5 cut(s) 41, 351, 371, 524, 532
AjnI CCWGG 3 cut(s) 146, 246, 584
AluBI AGCT 3 cut(s) 169, 184, 340
AluI AGCT 3 cut(s) 169, 184, 340
Alw21I GWGCWC 1 cut(s) 320
Alw26I GTCTC 1 cut(s) 82
AlwI GGATC 4 cut(s) 63, 206, 312, 567
AlwNI CAGNNNCTG 1 cut(s) 184
AoxI GGCC 3 cut(s) 432, 497, 627
ApeKI GCWGC 8 cut(s) 142, 151, 166, 175, 178, 181, 184, 193
ApoI RAATTY 1 cut(s) 298
AspS9I GGNCC 5 cut(s) 9, 250, 498, 595, 621
AsuHPI GGTGA 2 cut(s) 400, 414
AvaII GGWCC 4 cut(s) 9, 250, 595, 621
BalI TGGCCA 1 cut(s) 629
Bbv12I GWGCWC 1 cut(s) 320
BbvI GCAGC 8 cut(s) 138, 154, 171, 178, 187, 190, 193, 205
BccI CCATC 1 cut(s) 611
BceAI ACGGC 2 cut(s) 65, 181
BciT130I CCWGG 3 cut(s) 148, 248, 586
BclI TGATCA 1 cut(s) 234
BcoDI GTCTC 1 cut(s) 82
BfaI CTAG 2 cut(s) 272, 566
BfmI CTRYAG 1 cut(s) 164
BisI GCNGC 8 cut(s) 143, 152, 167, 176, 179, 182, 185, 194
BlsI GCNGC 8 cut(s) 144, 153, 168, 177, 180, 183, 186, 195
Bme1390I CCNGG 3 cut(s) 148, 248, 586
Bme18I GGWCC 4 cut(s) 9, 250, 595, 621
BmgT120I GGNCC 5 cut(s) 9, 250, 498, 595, 621
BmiI GGNNCC 1 cut(s) 622
BmrFI CCNGG 3 cut(s) 148, 248, 586
BmrI ACTGGG 1 cut(s) 434
BmsI GCATC 2 cut(s) 370, 414
BmuI ACTGGG 1 cut(s) 434
BpmI CTGGAG 3 cut(s) 418, 491, 607
BsaJI CCNNGG 4 cut(s) 146, 197, 494, 624
Bsc4I CCNNNNNNNGG 2 cut(s) 34, 259
Bse118I RCCGGY 1 cut(s) 34
Bse1I ACTGG 2 cut(s) 401, 440
BseBI CCWGG 3 cut(s) 148, 248, 586
BseDI CCNNGG 4 cut(s) 146, 197, 494, 624
BseGI GGATG 1 cut(s) 135
BseLI CCNNNNNNNGG 2 cut(s) 34, 259
BseMII CTCAG 3 cut(s) 127, 424, 598
BseNI ACTGG 2 cut(s) 401, 440
BseRI GAGGAG 1 cut(s) 398
BseXI GCAGC 8 cut(s) 138, 154, 171, 178, 187, 190, 193, 205
BshFI GGCC 3 cut(s) 434, 499, 629
BsiHKAI GWGCWC 1 cut(s) 320
BsiSI CCGG 1 cut(s) 35
BslI CCNNNNNNNGG 2 cut(s) 34, 259
BsmAI GTCTC 1 cut(s) 82
BsmBI CGTCTC 1 cut(s) 82
BsnI GGCC 3 cut(s) 434, 499, 629
Bsp1286I GDGCHC 1 cut(s) 320
Bsp143I GATC 5 cut(s) 55, 211, 234, 304, 559
Bsp19I CCATGG 1 cut(s) 494
BspANI GGCC 3 cut(s) 434, 499, 629
BspCNI CTCAG 3 cut(s) 126, 423, 599
BspHI TCATGA 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 622
BspMAI CTGCAG 1 cut(s) 168
BspPI GGATC 4 cut(s) 63, 206, 312, 567
BsrFI RCCGGY 1 cut(s) 34
BsrI ACTGG 2 cut(s) 401, 440
BssAI RCCGGY 1 cut(s) 34
BssECI CCNNGG 4 cut(s) 146, 197, 494, 624
BssMI GATC 5 cut(s) 55, 211, 234, 304, 559
BssT1I CCWWGG 1 cut(s) 494
Bst2UI CCWGG 3 cut(s) 148, 248, 586
Bst4CI ACNGT 4 cut(s) 206, 244, 327, 462
Bst6I CTCTTC 2 cut(s) 80, 346
BstAPI GCANNNNNTGC 2 cut(s) 172, 184
BstC8I GCNNGC 1 cut(s) 74
BstDEI CTNAG 3 cut(s) 113, 410, 607
BstDSI CCRYGG 3 cut(s) 197, 494, 624
BstENI CCTNNNNNAGG 1 cut(s) 257
BstF5I GGATG 1 cut(s) 135
BstKTI GATC 5 cut(s) 58, 214, 237, 307, 562
BstMAI GTCTC 1 cut(s) 82
BstMBI GATC 5 cut(s) 55, 211, 234, 304, 559
BstNI CCWGG 3 cut(s) 148, 248, 586
BstSCI CCNGG 3 cut(s) 146, 246, 584
BstSFI CTRYAG 1 cut(s) 164
BstV1I GCAGC 8 cut(s) 138, 154, 171, 178, 187, 190, 193, 205
BstX2I RGATCY 1 cut(s) 211
BstYI RGATCY 1 cut(s) 211
BsuRI GGCC 3 cut(s) 434, 499, 629
BtgI CCRYGG 3 cut(s) 197, 494, 624
BtsCI GGATG 1 cut(s) 135
BtsIMutI CAGTG 2 cut(s) 323, 394
Cac8I GCNNGC 1 cut(s) 74
CaiI CAGNNNCTG 1 cut(s) 184
CciI TCATGA 1 cut(s) 222
Cfr10I RCCGGY 1 cut(s) 34
Cfr13I GGNCC 5 cut(s) 9, 250, 498, 595, 621
Csp6I GTAC 1 cut(s) 491
CviAII CATG 4 cut(s) 139, 223, 495, 540
CviQI GTAC 1 cut(s) 491
DdeI CTNAG 3 cut(s) 113, 410, 607
DpnI GATC 5 cut(s) 57, 213, 236, 306, 561
DpnII GATC 5 cut(s) 55, 211, 234, 304, 559
DraI TTTAAA 1 cut(s) 81
EaeI YGGCCR 1 cut(s) 627
Eam1104I CTCTTC 2 cut(s) 80, 346
EarI CTCTTC 2 cut(s) 80, 346
Eco130I CCWWGG 1 cut(s) 494
Eco47I GGWCC 4 cut(s) 9, 250, 595, 621
Eco57I CTGAAG 1 cut(s) 362
EcoNI CCTNNNNNAGG 1 cut(s) 257
EcoRII CCWGG 3 cut(s) 146, 246, 584
EcoT14I CCWWGG 1 cut(s) 494
ErhI CCWWGG 1 cut(s) 494
Esp3I CGTCTC 1 cut(s) 82
FaeI CATG 4 cut(s) 142, 226, 498, 543
FaiI YATR 6 cut(s) 140, 173, 224, 430, 496, 541
FatI CATG 4 cut(s) 138, 222, 494, 539
FbaI TGATCA 1 cut(s) 234
Fnu4HI GCNGC 8 cut(s) 143, 152, 167, 176, 179, 182, 185, 194
FokI GGATG 1 cut(s) 142
Fsp4HI GCNGC 8 cut(s) 143, 152, 167, 176, 179, 182, 185, 194
FspBI CTAG 2 cut(s) 272, 566
GluI GCNGC 8 cut(s) 143, 152, 167, 176, 179, 182, 185, 194
GsuI CTGGAG 3 cut(s) 418, 491, 607
HaeIII GGCC 3 cut(s) 434, 499, 629
HapII CCGG 1 cut(s) 35
Hin1II CATG 4 cut(s) 142, 226, 498, 543
HinfI GANTC 6 cut(s) 160, 226, 283, 333, 379, 405
HpaII CCGG 1 cut(s) 35
HphI GGTGA 2 cut(s) 400, 414
Hpy188I TCNGA 8 cut(s) 116, 216, 231, 332, 378, 413, 423, 608
Hpy188III TCNNGA 6 cut(s) 12, 209, 223, 383, 508, 566
HpyAV CCTTC 3 cut(s) 530, 537, 563
HpyCH4III ACNGT 4 cut(s) 206, 244, 327, 462
HpyCH4V TGCA 5 cut(s) 72, 142, 166, 175, 187
HpyF3I CTNAG 3 cut(s) 113, 410, 607
Hsp92II CATG 4 cut(s) 142, 226, 498, 543
Ksp22I TGATCA 1 cut(s) 234
Kzo9I GATC 5 cut(s) 55, 211, 234, 304, 559
Lsp1109I GCAGC 8 cut(s) 138, 154, 171, 178, 187, 190, 193, 205
LweI GCATC 2 cut(s) 370, 414
MaeI CTAG 2 cut(s) 272, 566
MaeIII GTNAC 4 cut(s) 388, 402, 456, 475
MalI GATC 5 cut(s) 57, 213, 236, 306, 561
MboI GATC 5 cut(s) 55, 211, 234, 304, 559
MboII GAAGA 7 cut(s) 97, 129, 355, 356, 359, 363, 496
MflI RGATCY 1 cut(s) 211
MhlI GDGCHC 1 cut(s) 320
MlsI TGGCCA 1 cut(s) 629
MluCI AATT 2 cut(s) 298, 346
MluNI TGGCCA 1 cut(s) 629
MlyI GAGTC 3 cut(s) 169, 292, 399
MnlI CCTC 8 cut(s) 253, 297, 347, 379, 393, 419, 429, 549
Mox20I TGGCCA 1 cut(s) 629
MscI TGGCCA 1 cut(s) 629
MseI TTAA 2 cut(s) 80, 580
Msp20I TGGCCA 1 cut(s) 629
MspA1I CMGCKG 1 cut(s) 184
MspI CCGG 1 cut(s) 35
MspR9I CCNGG 3 cut(s) 148, 248, 586
MvaI CCWGG 3 cut(s) 148, 248, 586
NcoI CCATGG 1 cut(s) 494
NdeII GATC 5 cut(s) 55, 211, 234, 304, 559
NlaIII CATG 4 cut(s) 142, 226, 498, 543
NlaIV GGNNCC 1 cut(s) 622
NmuCI GTSAC 4 cut(s) 388, 402, 456, 475
PagI TCATGA 1 cut(s) 222
PfeI GAWTC 3 cut(s) 226, 333, 379
PkrI GCNGC 8 cut(s) 144, 153, 168, 177, 180, 183, 186, 195
PleI GAGTC 3 cut(s) 168, 291, 399
PpsI GAGTC 3 cut(s) 168, 291, 399
Psp6I CCWGG 3 cut(s) 146, 246, 584
PspGI CCWGG 3 cut(s) 146, 246, 584
PspN4I GGNNCC 1 cut(s) 622
PspPI GGNCC 5 cut(s) 9, 250, 498, 595, 621
PstI CTGCAG 1 cut(s) 168
PstNI CAGNNNCTG 1 cut(s) 184
PsuI RGATCY 1 cut(s) 211
PvuII CAGCTG 1 cut(s) 184
RsaI GTAC 1 cut(s) 492
RsaNI GTAC 1 cut(s) 491
SaqAI TTAA 2 cut(s) 80, 580
SatI GCNGC 8 cut(s) 143, 152, 167, 176, 179, 182, 185, 194
Sau3AI GATC 5 cut(s) 55, 211, 234, 304, 559
Sau96I GGNCC 5 cut(s) 9, 250, 498, 595, 621
SchI GAGTC 3 cut(s) 169, 292, 399
ScrFI CCNGG 3 cut(s) 148, 248, 586
SduI GDGCHC 1 cut(s) 320
SfaNI GCATC 2 cut(s) 370, 414
SfcI CTRYAG 1 cut(s) 164
SinI GGWCC 4 cut(s) 9, 250, 595, 621
Sse9I AATT 2 cut(s) 298, 346
SspMI CTAG 2 cut(s) 272, 566
StyD4I CCNGG 3 cut(s) 146, 246, 584
StyI CCWWGG 1 cut(s) 494
TaaI ACNGT 4 cut(s) 206, 244, 327, 462
TasI AATT 2 cut(s) 298, 346
TfiI GAWTC 3 cut(s) 226, 333, 379
Tru1I TTAA 2 cut(s) 80, 580
Tru9I TTAA 2 cut(s) 80, 580
TscAI CASTG 2 cut(s) 330, 401
TseFI GTSAC 4 cut(s) 388, 402, 456, 475
TseI GCWGC 8 cut(s) 142, 151, 166, 175, 178, 181, 184, 193
Tsp45I GTSAC 4 cut(s) 388, 402, 456, 475
TspDTI ATGAA 2 cut(s) 497, 556
TspGWI ACGGA 2 cut(s) 106, 613
TspRI CASTG 2 cut(s) 330, 401
VpaK11BI GGWCC 4 cut(s) 9, 250, 595, 621
XagI CCTNNNNNAGG 1 cut(s) 257
XapI RAATTY 1 cut(s) 298
XbaI TCTAGA 1 cut(s) 565
XspI CTAG 2 cut(s) 272, 566
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.