Rmu_co8146422.1_g000001

Alpha/beta hydrolase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8146422.1
OG0009477
Physical Location & Seq
Reverse (-)
1 .. 436
436 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8146422.1_g000001.1.cds

Sequence Viewer

Length: 297 bp
ctgataccaataattgcatttcagtgctaccatgatacctcccaagtgacagatgaactagttgaaaaaatccttcttccaggacttgagcctggtgccgtagacgtgtttttggagttcatttgttattcagatggccctctacctgaggaactattacctaaagtgaaatgtcctgttttgatagcatggggtgacaaggatccatgggaacctattgaacttggacgtgcctatgggaattttgaatctgtagaagactttgttgttcttcctaatgttggccactgccctcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_1 Abhydrolase_6

Protein Analysis

99

Amino Acids

11.04

Weight (kDa)

4.14

Isoelectric Point (pI)

32.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 95
AccI GTMKAC 1 cut(s) 102
AclWI GGATC 2 cut(s) 197, 210
AcoI YGGCCR 1 cut(s) 283
AcsI RAATTY 1 cut(s) 241
AfiI CCNNNNNNNGG 1 cut(s) 281
AflIII ACRYGT 1 cut(s) 105
AgsI TTSAA 3 cut(s) 65, 221, 248
AhlI ACTAGT 1 cut(s) 58
AjiI CACGTC 2 cut(s) 106, 230
AjnI CCWGG 2 cut(s) 79, 91
AlwI GGATC 2 cut(s) 197, 210
AoxI GGCC 2 cut(s) 136, 283
ApoI RAATTY 1 cut(s) 241
AspS9I GGNCC 1 cut(s) 137
AsuHPI GGTGA 1 cut(s) 206
AxyI CCTNAGG 1 cut(s) 147
BalI TGGCCA 1 cut(s) 285
BamHI GGATCC 1 cut(s) 202
BanI GGYRCC 1 cut(s) 95
BbsI GAAGAC 1 cut(s) 264
BccI CCATC 1 cut(s) 128
BceAI ACGGC 1 cut(s) 83
BciT130I CCWGG 2 cut(s) 81, 93
BcuI ACTAGT 1 cut(s) 58
BfaI CTAG 1 cut(s) 59
BfmI CTRYAG 1 cut(s) 252
Bme1390I CCNGG 2 cut(s) 81, 93
BmgBI CACGTC 2 cut(s) 106, 230
BmgT120I GGNCC 1 cut(s) 137
BmiI GGNNCC 3 cut(s) 97, 204, 213
BmrFI CCNGG 2 cut(s) 81, 93
BpiI GAAGAC 1 cut(s) 264
BpuEI CTTGAG 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 206
Bsc4I CCNNNNNNNGG 1 cut(s) 281
Bse21I CCTNAGG 1 cut(s) 147
BseBI CCWGG 2 cut(s) 81, 93
BseDI CCNNGG 1 cut(s) 206
BseLI CCNNNNNNNGG 1 cut(s) 281
BseMII CTCAG 1 cut(s) 138
BshFI GGCC 2 cut(s) 138, 285
BshNI GGYRCC 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 281
BsnI GGCC 2 cut(s) 138, 285
Bsp143I GATC 1 cut(s) 202
Bsp19I CCATGG 1 cut(s) 206
BspANI GGCC 2 cut(s) 138, 285
BspCNI CTCAG 1 cut(s) 139
BspLI GGNNCC 3 cut(s) 97, 204, 213
BspPI GGATC 2 cut(s) 197, 210
BspT107I GGYRCC 1 cut(s) 95
BssECI CCNNGG 1 cut(s) 206
BssMI GATC 1 cut(s) 202
BssT1I CCWWGG 1 cut(s) 206
Bst2UI CCWGG 2 cut(s) 81, 93
BstDEI CTNAG 2 cut(s) 147, 294
BstDSI CCRYGG 1 cut(s) 206
BstKTI GATC 1 cut(s) 205
BstMBI GATC 1 cut(s) 202
BstNI CCWGG 2 cut(s) 81, 93
BstSCI CCNGG 2 cut(s) 79, 91
BstSFI CTRYAG 1 cut(s) 252
BstV2I GAAGAC 1 cut(s) 264
BstX2I RGATCY 1 cut(s) 202
BstYI RGATCY 1 cut(s) 202
Bsu36I CCTNAGG 1 cut(s) 147
BsuRI GGCC 2 cut(s) 138, 285
BtgI CCRYGG 1 cut(s) 206
BtrI CACGTC 2 cut(s) 106, 230
BtsI GCAGTG 1 cut(s) 286
BtsIMutI CAGTG 2 cut(s) 29, 286
Cfr13I GGNCC 1 cut(s) 137
CviAII CATG 3 cut(s) 32, 189, 207
CviJI RGCY 3 cut(s) 91, 138, 285
CviKI_1 RGCY 3 cut(s) 91, 138, 285
DdeI CTNAG 2 cut(s) 147, 294
DpnI GATC 1 cut(s) 204
DpnII GATC 1 cut(s) 202
EaeI YGGCCR 1 cut(s) 283
Eco130I CCWWGG 1 cut(s) 206
Eco81I CCTNAGG 1 cut(s) 147
EcoRII CCWGG 2 cut(s) 79, 91
EcoT14I CCWWGG 1 cut(s) 206
ErhI CCWWGG 1 cut(s) 206
FaeI CATG 3 cut(s) 35, 192, 210
FaiI YATR 4 cut(s) 33, 190, 208, 237
FatI CATG 3 cut(s) 31, 188, 206
FblI GTMKAC 1 cut(s) 102
FspBI CTAG 1 cut(s) 59
HaeIII GGCC 2 cut(s) 138, 285
Hin1II CATG 3 cut(s) 35, 192, 210
HinfI GANTC 1 cut(s) 248
HphI GGTGA 1 cut(s) 206
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 133
Hpy8I GTNNAC 1 cut(s) 103
HpyAV CCTTC 1 cut(s) 83
HpyCH4IV ACGT 2 cut(s) 105, 229
HpyCH4V TGCA 1 cut(s) 17
HpyF3I CTNAG 2 cut(s) 147, 294
HpySE526I ACGT 2 cut(s) 105, 229
Hsp92II CATG 3 cut(s) 35, 192, 210
Kzo9I GATC 1 cut(s) 202
LpnPI CCDG 6 cut(s) 66, 78, 93, 105, 159, 189
MaeI CTAG 1 cut(s) 59
MaeII ACGT 2 cut(s) 105, 229
MaeIII GTNAC 2 cut(s) 46, 194
MalI GATC 1 cut(s) 204
MboI GATC 1 cut(s) 202
MboII GAAGA 3 cut(s) 68, 263, 269
MflI RGATCY 1 cut(s) 202
MlsI TGGCCA 1 cut(s) 285
MluCI AATT 2 cut(s) 12, 241
MluNI TGGCCA 1 cut(s) 285
MnlI CCTC 3 cut(s) 49, 142, 150
Mox20I TGGCCA 1 cut(s) 285
MscI TGGCCA 1 cut(s) 285
MslI CAYNNNNRTG 1 cut(s) 22
Msp20I TGGCCA 1 cut(s) 285
MspR9I CCNGG 2 cut(s) 81, 93
MvaI CCWGG 2 cut(s) 81, 93
NcoI CCATGG 1 cut(s) 206
NdeII GATC 1 cut(s) 202
NlaIII CATG 3 cut(s) 35, 192, 210
NlaIV GGNNCC 3 cut(s) 97, 204, 213
NmuCI GTSAC 2 cut(s) 46, 194
PfeI GAWTC 1 cut(s) 248
PfoI TCCNGGA 1 cut(s) 79
Psp6I CCWGG 2 cut(s) 79, 91
PspGI CCWGG 2 cut(s) 79, 91
PspN4I GGNNCC 3 cut(s) 97, 204, 213
PspPI GGNCC 1 cut(s) 137
PsuI RGATCY 1 cut(s) 202
RseI CAYNNNNRTG 1 cut(s) 22
Sau3AI GATC 1 cut(s) 202
Sau96I GGNCC 1 cut(s) 137
ScrFI CCNGG 2 cut(s) 81, 93
SetI ASST 6 cut(s) 41, 108, 148, 163, 217, 232
SfcI CTRYAG 1 cut(s) 252
SmiMI CAYNNNNRTG 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
SpeI ACTAGT 1 cut(s) 58
Sse9I AATT 2 cut(s) 12, 241
SspMI CTAG 1 cut(s) 59
StyD4I CCNGG 2 cut(s) 79, 91
StyI CCWWGG 1 cut(s) 206
TaiI ACGT 2 cut(s) 108, 232
TasI AATT 2 cut(s) 12, 241
TfiI GAWTC 1 cut(s) 248
TscAI CASTG 2 cut(s) 29, 293
TseFI GTSAC 2 cut(s) 46, 194
Tsp45I GTSAC 2 cut(s) 46, 194
TspDTI ATGAA 2 cut(s) 69, 109
TspRI CASTG 2 cut(s) 29, 293
XapI RAATTY 1 cut(s) 241
XmiI GTMKAC 1 cut(s) 102
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.