Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8148686.1

Orthogroup ID

OG0005609

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 504

Gene Structure 504 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8148686.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 339 bp

atgacttcagtcacgtcctctgtccagccatgttttgaggaaccaactggtttggatagatggattaagccgccatcgaatttgatgcacactatgaatgacgacgaactgttgtggagggcttctttgtcgtctaggagaaagaagtatccttttgatagagttcccaagattgcgcttatgttcttgactaaggggcctttgcctctggcaccaatttgggagaggtttctgaaggggcatgaaggattttattcagtctatgttcattcactgccatcatttcagcctcattttccaccttcctcggtttttcatgggagacatattcctagccag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Branch

Protein Analysis

113

Amino Acids

13.06

Weight (kDa)

9.51

Isoelectric Point (pI)

63.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005609)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G11730 AT5G25970 AT5G25970 AT5G25970
fragaria_vesca	FvH4_2g32250 FvH4_2g32250
malus_domestica	MD08G1073800.v1.1
prunus_persica	Prupe.1G415400_v2.0.a1 Prupe.1G415400_v2.0.a1 Prupe.1G415400_v2.0.a1 Prupe.1G415400_v2.0.a1 Prupe.1G415400_v2.0.a1 Prupe.1G415400_v2.0.a1 Prupe.1G415400_v2.0.a1 Prupe.1G415400_v2.0.a1
pyrus_communis	pycom08g06110 pycom15g05820
rosa_chinensis	RchiOBHm_Chr6g0310441
rosa_laevigata	RLG00000010482
rosa_multiflora	Rmu_co8148686.1_g000001 Rmu_sc0020729.1_g000015
rosa_roxburghii	Rroxscaffold_7G00158520
rosa_rugosa	Rorug06G0380400
rosa_samantha	Rh6AG494300 Rh6BG504100 Rh6CG509300 Rh6DG495300
rosa_wichuraiana	Rw6G043010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	211
AciI	CCGC	1 cut(s)	71
AcsI	RAATTY	1 cut(s)	79
AcuI	CTGAAG	1 cut(s)	254
AjiI	CACGTC	1 cut(s)	15
Alw26I	GTCTC	1 cut(s)	316
AoxI	GGCC	1 cut(s)	197
ApoI	RAATTY	1 cut(s)	79
AspLEI	GCGC	1 cut(s)	178
AspS9I	GGNCC	1 cut(s)	197
BanI	GGYRCC	1 cut(s)	211
BccI	CCATC	3 cut(s)	54, 82, 286
BcgI	CGANNNNNNTGC	2 cut(s)	67, 101
BciVI	GTATCC	1 cut(s)	159
BcoDI	GTCTC	1 cut(s)	316
BfaI	CTAG	2 cut(s)	135, 333
BfuI	GTATCC	1 cut(s)	159
BisI	GCNGC	1 cut(s)	71
BlsI	GCNGC	1 cut(s)	72
BmgBI	CACGTC	1 cut(s)	15
BmgT120I	GGNCC	1 cut(s)	197
BmiI	GGNNCC	3 cut(s)	42, 198, 213
BmsI	GCATC	1 cut(s)	75
BoxI	GACNNNNGTC	1 cut(s)	8
BsaJI	CCNNGG	1 cut(s)	306
Bse1I	ACTGG	1 cut(s)	52
BseDI	CCNNGG	1 cut(s)	306
BseNI	ACTGG	1 cut(s)	52
BshFI	GGCC	1 cut(s)	199
BshNI	GGYRCC	1 cut(s)	211
BsmAI	GTCTC	1 cut(s)	316
BsnI	GGCC	1 cut(s)	199
BspACI	CCGC	1 cut(s)	71
BspANI	GGCC	1 cut(s)	199
BspLI	GGNNCC	3 cut(s)	42, 198, 213
BspT107I	GGYRCC	1 cut(s)	211
BsrI	ACTGG	1 cut(s)	52
BssECI	CCNNGG	1 cut(s)	306
Bst4CI	ACNGT	1 cut(s)	111
BstDEI	CTNAG	1 cut(s)	192
BstHHI	GCGC	1 cut(s)	178
BstMAI	GTCTC	1 cut(s)	316
BstPAI	GACNNNNGTC	1 cut(s)	8
BsuI	GTATCC	1 cut(s)	159
BsuRI	GGCC	1 cut(s)	199
BtrI	CACGTC	1 cut(s)	15
BtsI	GCAGTG	1 cut(s)	272
BtsIMutI	CAGTG	1 cut(s)	272
CfoI	GCGC	1 cut(s)	178
Cfr13I	GGNCC	1 cut(s)	197
CviAII	CATG	3 cut(s)	30, 242, 317
CviJI	RGCY	6 cut(s)	28, 70, 122, 199, 289, 336
CviKI_1	RGCY	6 cut(s)	28, 70, 122, 199, 289, 336
DdeI	CTNAG	1 cut(s)	192
Eco57I	CTGAAG	1 cut(s)	254
EcoO109I	RGGNCCY	1 cut(s)	197
FaeI	CATG	3 cut(s)	33, 245, 320
FaiI	YATR	7 cut(s)	31, 95, 182, 243, 264, 318, 327
FatI	CATG	3 cut(s)	29, 241, 316
Fnu4HI	GCNGC	1 cut(s)	71
Fsp4HI	GCNGC	1 cut(s)	71
FspBI	CTAG	2 cut(s)	135, 333
GlaI	GCGC	1 cut(s)	177
GluI	GCNGC	1 cut(s)	71
HaeIII	GGCC	1 cut(s)	199
HhaI	GCGC	1 cut(s)	178
Hin1II	CATG	3 cut(s)	33, 245, 320
Hin6I	GCGC	1 cut(s)	176
HinP1I	GCGC	1 cut(s)	176
Hpy188I	TCNGA	1 cut(s)	234
Hpy188III	TCNNGA	1 cut(s)	187
Hpy99I	CGWCG	1 cut(s)	107
HpyAV	CCTTC	3 cut(s)	229, 239, 312
HpyCH4III	ACNGT	1 cut(s)	111
HpyCH4IV	ACGT	1 cut(s)	14
HpyCH4V	TGCA	1 cut(s)	88
HpyF3I	CTNAG	1 cut(s)	192
HpySE526I	ACGT	1 cut(s)	14
Hsp92II	CATG	3 cut(s)	33, 245, 320
HspAI	GCGC	1 cut(s)	176
LpnPI	CCDG	3 cut(s)	33, 38, 194
LweI	GCATC	1 cut(s)	75
MaeI	CTAG	2 cut(s)	135, 333
MaeII	ACGT	1 cut(s)	14
MaeIII	GTNAC	1 cut(s)	10
MluCI	AATT	2 cut(s)	79, 216
MnlI	CCTC	7 cut(s)	28, 31, 111, 216, 219, 300, 316
MseI	TTAA	1 cut(s)	66
NlaIII	CATG	3 cut(s)	33, 245, 320
NlaIV	GGNNCC	3 cut(s)	42, 198, 213
NmuCI	GTSAC	1 cut(s)	10
PkrI	GCNGC	1 cut(s)	72
PshAI	GACNNNNGTC	1 cut(s)	8
PspN4I	GGNNCC	3 cut(s)	42, 198, 213
PspPI	GGNCC	1 cut(s)	197
SaqAI	TTAA	1 cut(s)	66
SatI	GCNGC	1 cut(s)	71
Sau96I	GGNCC	1 cut(s)	197
SetI	ASST	3 cut(s)	17, 230, 304
SfaNI	GCATC	1 cut(s)	75
Sse9I	AATT	2 cut(s)	79, 216
SsiI	CCGC	1 cut(s)	71
SspMI	CTAG	2 cut(s)	135, 333
TaaI	ACNGT	1 cut(s)	111
TaiI	ACGT	1 cut(s)	17
TaqI	TCGA	1 cut(s)	77
TasI	AATT	2 cut(s)	79, 216
TauI	GCSGC	1 cut(s)	73
Tru1I	TTAA	1 cut(s)	66
Tru9I	TTAA	1 cut(s)	66
TscAI	CASTG	1 cut(s)	279
TseFI	GTSAC	1 cut(s)	10
Tsp45I	GTSAC	1 cut(s)	10
TspDTI	ATGAA	4 cut(s)	110, 257, 258, 305
TspRI	CASTG	1 cut(s)	279
XapI	RAATTY	1 cut(s)	79
XspI	CTAG	2 cut(s)	135, 333

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.