Rmu_co8155456.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8155456.1
Physical Location & Seq
Reverse (-)
274 .. 656
383 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8155456.1_g000001.1.cds

Sequence Viewer

Length: 290 bp
attccctttgtttcattgtccagaattcacagaatgacgcaaggaaggaagtttacaaagacaccacagataatctaaatgacagaggaaaagaattcggcaaggacgacataccagataataatagaaaagatttagaaaaggggtttcctttgaacagaccaccaagaaaaacaatgaaggatggctcgtctgttgtctttattaaaggcattcccacatatgagaaaaatgaaggaaagcttcctaggaagtgtctcaaggacagccaaaggaaatacaaggcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.98

Weight (kDa)

9.52

Isoelectric Point (pI)

11.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012071)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 24, 94
AgsI TTSAA 1 cut(s) 156
AluBI AGCT 1 cut(s) 243
AluI AGCT 1 cut(s) 243
Alw26I GTCTC 1 cut(s) 262
ApoI RAATTY 2 cut(s) 24, 94
AspA2I CCTAGG 1 cut(s) 247
AvrII CCTAGG 1 cut(s) 247
BarI GAAGNNNNNNTAC 2 cut(s) 37, 69
BccI CCATC 1 cut(s) 178
BcoDI GTCTC 1 cut(s) 262
BfaI CTAG 1 cut(s) 248
BlnI CCTAGG 1 cut(s) 247
BpuEI CTTGAG 1 cut(s) 244
BsaJI CCNNGG 1 cut(s) 247
BseDI CCNNGG 1 cut(s) 247
BseGI GGATG 1 cut(s) 189
BsmAI GTCTC 1 cut(s) 262
BsmI GAATGC 1 cut(s) 212
BssECI CCNNGG 1 cut(s) 247
BssT1I CCWWGG 1 cut(s) 247
BstF5I GGATG 1 cut(s) 189
BstMAI GTCTC 1 cut(s) 262
BtsCI GGATG 1 cut(s) 189
CseI GACGC 1 cut(s) 46
CviJI RGCY 4 cut(s) 188, 243, 269, 286
CviKI_1 RGCY 4 cut(s) 188, 243, 269, 286
Eco130I CCWWGG 1 cut(s) 247
EcoRI GAATTC 2 cut(s) 24, 94
EcoT14I CCWWGG 1 cut(s) 247
ErhI CCWWGG 1 cut(s) 247
FaiI YATR 3 cut(s) 112, 222, 224
FalI AAGNNNNNCTT 2 cut(s) 227, 259
FauNDI CATATG 1 cut(s) 222
FokI GGATG 1 cut(s) 196
FspBI CTAG 1 cut(s) 248
HgaI GACGC 1 cut(s) 46
HindIII AAGCTT 1 cut(s) 241
Hpy166II GTNNAC 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 54
HpyAV CCTTC 3 cut(s) 39, 174, 229
LpnPI CCDG 2 cut(s) 34, 128
MaeI CTAG 1 cut(s) 248
MluCI AATT 2 cut(s) 24, 94
MnlI CCTC 1 cut(s) 79
MseI TTAA 1 cut(s) 206
Mva1269I GAATGC 1 cut(s) 212
NdeI CATATG 1 cut(s) 222
PcsI WCGNNNNNNNCGW 1 cut(s) 104
PctI GAATGC 1 cut(s) 212
SaqAI TTAA 1 cut(s) 206
SetI ASST 1 cut(s) 245
SgeI CNNG 8 cut(s) 33, 53, 114, 127, 179, 201, 260, 273
SmlI CTYRAG 1 cut(s) 259
SmoI CTYRAG 1 cut(s) 259
Sse9I AATT 2 cut(s) 24, 94
SspMI CTAG 1 cut(s) 248
StyI CCWWGG 1 cut(s) 247
TasI AATT 2 cut(s) 24, 94
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
TspDTI ATGAA 2 cut(s) 193, 248
XapI RAATTY 2 cut(s) 24, 94
XmaJI CCTAGG 1 cut(s) 247
XspI CTAG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.