Rmu_co8160296.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8160296.1
Physical Location & Seq
Forward (+)
143 .. 661
519 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8160296.1_g000001.1.cds

Sequence Viewer

Length: 519 bp
atgggcaaacacctcatcttcaccgcagtgtcactctcatccccaatgtcctatgcccaccaagtattctcccaaatccaatggcccaatgtgttcacatggaacaccatgattagaggctacgccgagagccaaaacccaatgcctgtgattcaactctaccaccaaatgcgtgtgaattctgtcgaacccgatacgcatacatacccttttctcttgaaggctgtggctaagttgttgaatgtgagagagggggagaagatacattccgttgctctgagaaatgggctggagtcgttggtctttgttaagaacgctttgcttcacatgtacgccgtttgtgggcaggtggagagtgcatacgaggtgtttgaatcaatgtctgagagagaccttgtggcttggaactctgtgattaatgggttttccttgaatggaaggcctaatgaggctctgactatatttagggagatgagtttggagggtgttgagccggatgggttcaccatggttagcttg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

19.57

Weight (kDa)

5.83

Isoelectric Point (pI)

35.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013500)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 337
Acc36I ACCTGC 1 cut(s) 337
AciI CCGC 1 cut(s) 24
AcsI RAATTY 1 cut(s) 178
AfaI GTAC 1 cut(s) 332
AfiI CCNNNNNNNGG 1 cut(s) 342
AflIII ACRYGT 1 cut(s) 327
AgsI TTSAA 5 cut(s) 155, 220, 241, 374, 433
AleI CACNNNNGTG 1 cut(s) 26
AluBI AGCT 1 cut(s) 516
AluI AGCT 1 cut(s) 516
Alw26I GTCTC 1 cut(s) 384
AoxI GGCC 2 cut(s) 83, 440
ApoI RAATTY 1 cut(s) 178
AseI ATTAAT 1 cut(s) 417
AspS9I GGNCC 1 cut(s) 84
AsuHPI GGTGA 2 cut(s) 13, 496
BccI CCATC 1 cut(s) 491
BceAI ACGGC 1 cut(s) 320
BcoDI GTCTC 1 cut(s) 384
BfuAI ACCTGC 1 cut(s) 337
BmgT120I GGNCC 1 cut(s) 84
BpmI CTGGAG 1 cut(s) 311
BsaI GGTCTC 1 cut(s) 384
BsaJI CCNNGG 1 cut(s) 507
Bsc4I CCNNNNNNNGG 1 cut(s) 342
BseDI CCNNGG 1 cut(s) 507
BseGI GGATG 2 cut(s) 38, 502
BseLI CCNNNNNNNGG 1 cut(s) 342
BseMII CTCAG 2 cut(s) 269, 375
BshFI GGCC 2 cut(s) 85, 442
BsiSI CCGG 1 cut(s) 494
BslI CCNNNNNNNGG 1 cut(s) 342
BsmAI GTCTC 1 cut(s) 384
BsnI GGCC 2 cut(s) 85, 442
Bso31I GGTCTC 1 cut(s) 384
Bsp19I CCATGG 1 cut(s) 507
BspACI CCGC 1 cut(s) 24
BspANI GGCC 2 cut(s) 85, 442
BspCNI CTCAG 2 cut(s) 270, 376
BspMI ACCTGC 1 cut(s) 337
BspTNI GGTCTC 1 cut(s) 384
BssECI CCNNGG 1 cut(s) 507
BssT1I CCWWGG 1 cut(s) 507
BstDEI CTNAG 3 cut(s) 231, 278, 384
BstDSI CCRYGG 1 cut(s) 507
BstF5I GGATG 2 cut(s) 38, 502
BstMAI GTCTC 1 cut(s) 384
BstNSI RCATGY 1 cut(s) 331
BsuRI GGCC 2 cut(s) 85, 442
BtgI CCRYGG 1 cut(s) 507
BtsCI GGATG 2 cut(s) 38, 502
BtsI GCAGTG 1 cut(s) 33
BtsIMutI CAGTG 1 cut(s) 33
BveI ACCTGC 1 cut(s) 337
Cfr13I GGNCC 1 cut(s) 84
Csp6I GTAC 1 cut(s) 331
CviAII CATG 4 cut(s) 99, 109, 328, 508
CviQI GTAC 1 cut(s) 331
DdeI CTNAG 3 cut(s) 231, 278, 384
Eco130I CCWWGG 1 cut(s) 507
Eco147I AGGCCT 1 cut(s) 442
Eco31I GGTCTC 1 cut(s) 384
EcoRI GAATTC 1 cut(s) 178
EcoT14I CCWWGG 1 cut(s) 507
ErhI CCWWGG 1 cut(s) 507
FaeI CATG 4 cut(s) 102, 112, 331, 511
FaiI YATR 9 cut(s) 54, 100, 110, 201, 205, 329, 361, 461, 509
FatI CATG 4 cut(s) 98, 108, 327, 507
FokI GGATG 2 cut(s) 25, 509
GsuI CTGGAG 1 cut(s) 311
HaeIII GGCC 2 cut(s) 85, 442
HapII CCGG 1 cut(s) 494
Hin1II CATG 4 cut(s) 102, 112, 331, 511
HinfI GANTC 3 cut(s) 151, 293, 374
HpaII CCGG 1 cut(s) 494
HphI GGTGA 2 cut(s) 13, 496
Hpy166II GTNNAC 2 cut(s) 96, 504
Hpy188I TCNGA 3 cut(s) 279, 385, 456
Hpy188III TCNNGA 1 cut(s) 217
Hpy8I GTNNAC 2 cut(s) 96, 504
HpyAV CCTTC 2 cut(s) 214, 432
HpyCH4V TGCA 1 cut(s) 359
HpyF3I CTNAG 3 cut(s) 231, 278, 384
Hsp92II CATG 4 cut(s) 102, 112, 331, 511
LpnPI CCDG 4 cut(s) 159, 275, 332, 507
MaeIII GTNAC 1 cut(s) 30
MboII GAAGA 2 cut(s) 10, 271
MluCI AATT 1 cut(s) 178
MlyI GAGTC 1 cut(s) 302
MnlI CCTC 6 cut(s) 23, 110, 244, 358, 442, 475
MseI TTAA 2 cut(s) 309, 417
MslI CAYNNNNRTG 1 cut(s) 26
MspI CCGG 1 cut(s) 494
NcoI CCATGG 1 cut(s) 507
NlaIII CATG 4 cut(s) 102, 112, 331, 511
NmeAIII GCCGAG 1 cut(s) 151
NmuCI GTSAC 1 cut(s) 30
NspI RCATGY 1 cut(s) 331
OliI CACNNNNGTG 1 cut(s) 26
PaqCI CACCTGC 1 cut(s) 337
PceI AGGCCT 1 cut(s) 442
PciI ACATGT 1 cut(s) 327
PfeI GAWTC 2 cut(s) 151, 374
PleI GAGTC 1 cut(s) 301
PpsI GAGTC 1 cut(s) 301
PscI ACATGT 1 cut(s) 327
PshBI ATTAAT 1 cut(s) 417
PspPI GGNCC 1 cut(s) 84
RsaI GTAC 1 cut(s) 332
RsaNI GTAC 1 cut(s) 331
RseI CAYNNNNRTG 1 cut(s) 26
SaqAI TTAA 2 cut(s) 309, 417
Sau96I GGNCC 1 cut(s) 84
SchI GAGTC 1 cut(s) 302
SetI ASST 5 cut(s) 15, 351, 369, 396, 518
SmiMI CAYNNNNRTG 1 cut(s) 26
Sse9I AATT 1 cut(s) 178
SseBI AGGCCT 1 cut(s) 442
SsiI CCGC 1 cut(s) 24
StuI AGGCCT 1 cut(s) 442
StyI CCWWGG 1 cut(s) 507
TaqI TCGA 1 cut(s) 186
TasI AATT 1 cut(s) 178
TfiI GAWTC 2 cut(s) 151, 374
Tru1I TTAA 2 cut(s) 309, 417
Tru9I TTAA 2 cut(s) 309, 417
TscAI CASTG 1 cut(s) 33
TseFI GTSAC 1 cut(s) 30
Tsp45I GTSAC 1 cut(s) 30
TspGWI ACGGA 1 cut(s) 259
TspRI CASTG 1 cut(s) 33
VspI ATTAAT 1 cut(s) 417
XapI RAATTY 1 cut(s) 178
XceI RCATGY 1 cut(s) 331
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.