Rmu_sc0036572.1_g000001

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036572.1
OG0013500
Physical Location & Seq
Forward (+)
34 .. 1182
1149 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036572.1_g000001.1.cds

Sequence Viewer

Length: 1149 bp
atgagtttggagggtgttgagccggatgggttcaccatggttagcttgctgtgtgcttgtgccgagcttggggctttggctttgggtgggagggttcatgtgtatatgttgaaggtgggtttgacaaggaatgcgcatgctagtaatgcgcttctggatgtttatgcaaagtgtggaagcataagggaggcgcagaaggtgtttgaagaaatggaggagaggagtgtggtttcgtggactgctttggttgttgggttggctgttaatgggtttggtaaggaagcattggagctttttaaagagtttaaaagagagggattggtgccgactgagataacttttgttggggttctgtatgcctgtagtcattgcgggatggttgatgaagggtttgagtactttagagtgatgaaagaggagtatcggattgtgcccagaatagaacattatggttgcatggttgatttgttagctagagcaggcttggtgaaggaagcgtatgaatacattaaggacatgcctgttcaccccaatgctgttatttggaggaccttattaggagcatgcaccatacatgggcaatcggctctaggggagattgcaagaggccacatcctgcagttagaacctagacatagtggggattatgtgctgatctccaatctctacgcatctgagcgtcgatggtcggatgtgcaaaaggtgaggaggacaatgcttagtgaaggtgtgaagaaaactccgggctatagtattgttgagttaaggaacagagttttcgagtttactatgggtgacagatctcatccacaaagtgatgagatatatgcaaagctggtagagattacaaaattactgaaacagaaaggttatgtgcctcatacggagaatgttcttgcagacatagaggaggaagaaaaagaaaatgctttgtcctatcacagtgaaaaaattgcaattgcattcatgctcctagttagcgcaccaggcataccaattaggatttggaagaatttgagagtttgtgcagattgtcatcttgcatttaagctcatctcaaaggtttatgatcgggagattgttgtgagggatcgtagccgatttcaccattttagagatggttcttgttcttgtagtgattactggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2 X8

Protein Analysis

382

Amino Acids

43.26

Weight (kDa)

6.41

Isoelectric Point (pI)

46.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013500)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21065 AT4G21065
fragaria_vesca FvH4_3g09500
malus_domestica MD05G1277300.v1.1 MD10G1256200.v1.1
prunus_persica Prupe.4G087400_v2.0.a1
pyrus_communis pycom05g25840 pycom10g21200
rosa_chinensis RchiOBHm_Chr5g0015081
rosa_laevigata RLG00000032168
rosa_multiflora Rmu_co8160296.1_g000001 Rmu_sc0002209.1_g000002 Rmu_sc0009777.1_g000014 Rmu_sc0036572.1_g000001
rosa_roxburghii Rroxscaffold_1G00061450
rosa_rugosa Rorug05G0024200
rosa_samantha Rh5CG127500
rosa_wichuraiana Rw5G010250

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 135
AccB1I GGYRCC 1 cut(s) 322
AciI CCGC 1 cut(s) 372
AclWI GGATC 1 cut(s) 1098
AcsI RAATTY 1 cut(s) 1012
AdeI CACNNNGTG 1 cut(s) 815
AfaI GTAC 1 cut(s) 398
AfiI CCNNNNNNNGG 2 cut(s) 69, 576
AgsI TTSAA 2 cut(s) 112, 206
AjnI CCWGG 1 cut(s) 985
AluBI AGCT 6 cut(s) 45, 67, 292, 473, 835, 1051
AluI AGCT 6 cut(s) 45, 67, 292, 473, 835, 1051
AlwI GGATC 1 cut(s) 1098
AoxI GGCC 1 cut(s) 607
ApoI RAATTY 1 cut(s) 1012
AspLEI GCGC 4 cut(s) 136, 151, 193, 983
AspS9I GGNCC 1 cut(s) 549
AsuC2I CCSGG 1 cut(s) 744
AsuHPI GGTGA 6 cut(s) 25, 499, 518, 715, 806, 1097
AvaII GGWCC 1 cut(s) 549
BaeGI GKGCMC 1 cut(s) 435
BanI GGYRCC 1 cut(s) 322
BccI CCATC 4 cut(s) 20, 370, 678, 1112
BciT130I CCWGG 1 cut(s) 987
BcnI CCSGG 1 cut(s) 744
BfaI CTAG 5 cut(s) 141, 474, 590, 630, 974
BfmI CTRYAG 3 cut(s) 361, 617, 748
BglII AGATCT 1 cut(s) 800
BmcAI AGTACT 1 cut(s) 398
Bme1390I CCNGG 2 cut(s) 744, 987
Bme18I GGWCC 1 cut(s) 549
BmgT120I GGNCC 1 cut(s) 549
BmiI GGNNCC 1 cut(s) 324
BmrFI CCNGG 2 cut(s) 744, 987
BmsI GCATC 1 cut(s) 680
BpuMI CCSGG 1 cut(s) 744
BsaBI GATNNNNATC 1 cut(s) 1035
BsaJI CCNNGG 1 cut(s) 36
Bsc4I CCNNNNNNNGG 2 cut(s) 69, 576
Bse1I ACTGG 1 cut(s) 1148
Bse3DI GCAATG 1 cut(s) 367
Bse8I GATNNNNATC 1 cut(s) 1035
BseBI CCWGG 1 cut(s) 987
BseDI CCNNGG 1 cut(s) 36
BseGI GGATG 6 cut(s) 31, 163, 381, 612, 697, 805
BseJI GATNNNNATC 1 cut(s) 1035
BseLI CCNNNNNNNGG 2 cut(s) 69, 576
BseMI GCAATG 1 cut(s) 367
BseMII CTCAG 2 cut(s) 321, 666
BseNI ACTGG 1 cut(s) 1148
BseRI GAGGAG 5 cut(s) 230, 235, 431, 721, 923
BseSI GKGCMC 1 cut(s) 435
BsgI GTGCAG 1 cut(s) 1047
BshFI GGCC 1 cut(s) 609
BshNI GGYRCC 1 cut(s) 322
BsiSI CCGG 2 cut(s) 23, 743
BslI CCNNNNNNNGG 2 cut(s) 69, 576
BsmI GAATGC 2 cut(s) 136, 962
BsnI GGCC 1 cut(s) 609
Bsp1286I GDGCHC 1 cut(s) 435
Bsp143I GATC 4 cut(s) 654, 800, 1069, 1090
Bsp19I CCATGG 1 cut(s) 36
BspACI CCGC 1 cut(s) 372
BspANI GGCC 1 cut(s) 609
BspCNI CTCAG 2 cut(s) 322, 667
BspLI GGNNCC 1 cut(s) 324
BspMAI CTGCAG 1 cut(s) 621
BspPI GGATC 1 cut(s) 1098
BspT107I GGYRCC 1 cut(s) 322
BsrDI GCAATG 1 cut(s) 367
BsrI ACTGG 1 cut(s) 1148
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 4 cut(s) 654, 800, 1069, 1090
BssT1I CCWWGG 1 cut(s) 36
Bst2UI CCWGG 1 cut(s) 987
Bst4CI ACNGT 1 cut(s) 944
BstC8I GCNNGC 4 cut(s) 47, 138, 481, 565
BstDEI CTNAG 3 cut(s) 330, 675, 719
BstDSI CCRYGG 1 cut(s) 36
BstF5I GGATG 6 cut(s) 31, 163, 381, 612, 697, 805
BstHHI GCGC 4 cut(s) 136, 151, 193, 983
BstKTI GATC 4 cut(s) 657, 803, 1072, 1093
BstMBI GATC 4 cut(s) 654, 800, 1069, 1090
BstMWI GCNNNNNNNGC 2 cut(s) 146, 987
BstNI CCWGG 1 cut(s) 987
BstNSI RCATGY 3 cut(s) 140, 520, 567
BstSCI CCNGG 2 cut(s) 742, 985
BstSFI CTRYAG 3 cut(s) 361, 617, 748
BstSLI GKGCMC 1 cut(s) 435
BstX2I RGATCY 1 cut(s) 800
BstYI RGATCY 1 cut(s) 800
BsuRI GGCC 1 cut(s) 609
BtgI CCRYGG 1 cut(s) 36
BtsCI GGATG 6 cut(s) 31, 163, 381, 612, 697, 805
BtsIMutI CAGTG 1 cut(s) 949
Cac8I GCNNGC 4 cut(s) 47, 138, 481, 565
CfoI GCGC 4 cut(s) 136, 151, 193, 983
Cfr13I GGNCC 1 cut(s) 549
CseI GACGC 1 cut(s) 668
Csp6I GTAC 1 cut(s) 397
CviAII CATG 8 cut(s) 37, 98, 137, 457, 517, 564, 575, 967
CviQI GTAC 1 cut(s) 397
DdeI CTNAG 3 cut(s) 330, 675, 719
DpnI GATC 4 cut(s) 656, 802, 1071, 1092
DpnII GATC 4 cut(s) 654, 800, 1069, 1090
DraI TTTAAA 2 cut(s) 298, 307
DraIII CACNNNGTG 1 cut(s) 815
Eco130I CCWWGG 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 549
EcoO109I RGGNCCY 1 cut(s) 549
EcoRII CCWGG 1 cut(s) 985
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 8 cut(s) 40, 101, 140, 460, 520, 567, 578, 970
FatI CATG 8 cut(s) 36, 97, 136, 456, 516, 563, 574, 966
FauI CCCGC 1 cut(s) 365
FokI GGATG 6 cut(s) 38, 170, 388, 599, 704, 792
FspAI RTGCGCAY 1 cut(s) 135
FspBI CTAG 5 cut(s) 141, 474, 590, 630, 974
FspI TGCGCA 1 cut(s) 135
GlaI GCGC 4 cut(s) 135, 150, 192, 982
HaeIII GGCC 1 cut(s) 609
HapII CCGG 2 cut(s) 23, 743
HgaI GACGC 1 cut(s) 668
HhaI GCGC 4 cut(s) 136, 151, 193, 983
Hin1II CATG 8 cut(s) 40, 101, 140, 460, 520, 567, 578, 970
Hin6I GCGC 4 cut(s) 134, 149, 191, 981
HinP1I GCGC 4 cut(s) 134, 149, 191, 981
HpaII CCGG 2 cut(s) 23, 743
HphI GGTGA 6 cut(s) 25, 499, 518, 715, 806, 1097
Hpy166II GTNNAC 4 cut(s) 33, 237, 526, 786
Hpy188I TCNGA 3 cut(s) 426, 676, 691
Hpy188III TCNNGA 2 cut(s) 155, 1073
Hpy8I GTNNAC 4 cut(s) 33, 237, 526, 786
Hpy99I CGWCG 1 cut(s) 684
HpyAV CCTTC 5 cut(s) 106, 190, 380, 484, 719
HpyCH4III ACNGT 1 cut(s) 944
HpyF10VI GCNNNNNNNGC 2 cut(s) 146, 987
HpyF3I CTNAG 3 cut(s) 330, 675, 719
Hsp92II CATG 8 cut(s) 40, 101, 140, 460, 520, 567, 578, 970
HspAI GCGC 4 cut(s) 134, 149, 191, 981
Kzo9I GATC 4 cut(s) 654, 800, 1069, 1090
LmnI GCTCC 3 cut(s) 289, 560, 975
LweI GCATC 1 cut(s) 680
MaeI CTAG 5 cut(s) 141, 474, 590, 630, 974
MaeIII GTNAC 1 cut(s) 794
MalI GATC 4 cut(s) 656, 802, 1071, 1092
MboI GATC 4 cut(s) 654, 800, 1069, 1090
MboII GAAGA 4 cut(s) 218, 745, 926, 1021
MfeI CAATTG 1 cut(s) 957
MflI RGATCY 1 cut(s) 800
MhlI GDGCHC 1 cut(s) 435
MluCI AATT 5 cut(s) 851, 951, 957, 996, 1012
MmeI TCCRAC 1 cut(s) 669
MseI TTAA 6 cut(s) 264, 297, 306, 510, 764, 1047
MslI CAYNNNNRTG 1 cut(s) 531
MspI CCGG 2 cut(s) 23, 743
MspR9I CCNGG 2 cut(s) 744, 987
MunI CAATTG 1 cut(s) 957
Mva1269I GAATGC 2 cut(s) 136, 962
MvaI CCWGG 1 cut(s) 987
MwoI GCNNNNNNNGC 2 cut(s) 146, 987
NciI CCSGG 1 cut(s) 744
NcoI CCATGG 1 cut(s) 36
NdeII GATC 4 cut(s) 654, 800, 1069, 1090
NlaIII CATG 8 cut(s) 40, 101, 140, 460, 520, 567, 578, 970
NlaIV GGNNCC 1 cut(s) 324
NmeAIII GCCGAG 1 cut(s) 88
NmuCI GTSAC 1 cut(s) 794
NsbI TGCGCA 1 cut(s) 135
NspI RCATGY 3 cut(s) 140, 520, 567
PaeI GCATGC 2 cut(s) 140, 567
PctI GAATGC 2 cut(s) 136, 962
PpuMI RGGWCCY 1 cut(s) 549
Psp5II RGGWCCY 1 cut(s) 549
Psp6I CCWGG 1 cut(s) 985
PspGI CCWGG 1 cut(s) 985
PspN4I GGNNCC 1 cut(s) 324
PspPI GGNCC 1 cut(s) 549
PspPPI RGGWCCY 1 cut(s) 549
PstI CTGCAG 1 cut(s) 621
PsuI RGATCY 1 cut(s) 800
RsaI GTAC 1 cut(s) 398
RsaNI GTAC 1 cut(s) 397
RseI CAYNNNNRTG 1 cut(s) 531
SaqAI TTAA 6 cut(s) 264, 297, 306, 510, 764, 1047
Sau3AI GATC 4 cut(s) 654, 800, 1069, 1090
Sau96I GGNCC 1 cut(s) 549
ScaI AGTACT 1 cut(s) 398
ScrFI CCNGG 2 cut(s) 744, 987
SduI GDGCHC 1 cut(s) 435
SfaNI GCATC 1 cut(s) 680
SfcI CTRYAG 3 cut(s) 361, 617, 748
SinI GGWCC 1 cut(s) 549
SmiMI CAYNNNNRTG 1 cut(s) 531
SphI GCATGC 2 cut(s) 140, 567
Sse9I AATT 5 cut(s) 851, 951, 957, 996, 1012
SsiI CCGC 1 cut(s) 372
SspMI CTAG 5 cut(s) 141, 474, 590, 630, 974
StyD4I CCNGG 2 cut(s) 742, 985
StyI CCWWGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 944
TaqI TCGA 2 cut(s) 682, 780
TasI AATT 5 cut(s) 851, 951, 957, 996, 1012
TatI WGTACW 1 cut(s) 396
Tru1I TTAA 6 cut(s) 264, 297, 306, 510, 764, 1047
Tru9I TTAA 6 cut(s) 264, 297, 306, 510, 764, 1047
TscAI CASTG 1 cut(s) 949
TseFI GTSAC 1 cut(s) 794
Tsp45I GTSAC 1 cut(s) 794
TspDTI ATGAA 5 cut(s) 86, 399, 425, 516, 955
TspGWI ACGGA 1 cut(s) 899
TspRI CASTG 1 cut(s) 949
VpaK11BI GGWCC 1 cut(s) 549
XapI RAATTY 1 cut(s) 1012
XceI RCATGY 3 cut(s) 140, 520, 567
XcmI CCANNNNNNNNNTGG 2 cut(s) 1002, 1115
XspI CTAG 5 cut(s) 141, 474, 590, 630, 974
ZrmI AGTACT 1 cut(s) 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.