Rmu_sc0009777.1_g000014

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009777.1
OG0013500
Physical Location & Seq
Forward (+)
55973 .. 56881
909 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009777.1_g000014.1.cds

Sequence Viewer

Length: 909 bp
atgctcccaaagcagccctcactcacccacacaatctcaactaccttaactcatcacaacccagtttcaagcttgtctttcccaacccgcccacaaaatccactccccttcatcctccaaaaatgcattgctctcctgcaaagctgtgcctcctccatttccaaactcaaacaaatccacgccttctctttacgacatggcgtccctctctccaacccagatatgggcaaacacctcatcttcaccgcagtgtcactctcatccccaatgtcctatgcccaccaagtattctcccaaatccaatggcccaatgtgttcacatggaacaccatgattagaggctacgccgagagccaaaacccaatgcctgtgattcaactctaccaccaaatgcgtgtgaattctgtcgaacccgatacgcatacatacccttttctcttgaaggctgtggctaagttgttgaatgtgagagagggggagaagatacattccgttgctctgagaaatgggctggagtcgttggtctttgttaagaacgctttgcttcacatgtacgccgtttgtgggcaggtggagagtgcatacgaggtgtttgaatcaatgtctgagagagaccttgtggcttggaactctgtgattaatgggttttccttgaatggaaggcctaatgaggctctgactatatttagggagatgagtttggagggtgttgagccggatgggttcaccatggttagcttgttgtgtgcttgtgccgagcttggagctttggctttgggtgggagggttcatgtgtatatgttgaaggtgagttggacaaggaattctcatgctagtaatgcgcttctggatgtttatgcaaagtgtggaagcataagggaggcgcagaaggtgtttgaagaaatggag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2 X8

Protein Analysis

303

Amino Acids

33.8

Weight (kDa)

7.72

Isoelectric Point (pI)

43.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013500)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21065 AT4G21065
fragaria_vesca FvH4_3g09500
malus_domestica MD05G1277300.v1.1 MD10G1256200.v1.1
prunus_persica Prupe.4G087400_v2.0.a1
pyrus_communis pycom05g25840 pycom10g21200
rosa_chinensis RchiOBHm_Chr5g0015081
rosa_laevigata RLG00000032168
rosa_multiflora Rmu_co8160296.1_g000001 Rmu_sc0002209.1_g000002 Rmu_sc0009777.1_g000014 Rmu_sc0036572.1_g000001
rosa_roxburghii Rroxscaffold_1G00061450
rosa_rugosa Rorug05G0024200
rosa_samantha Rh5CG127500
rosa_wichuraiana Rw5G010250

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 559
Acc36I ACCTGC 1 cut(s) 559
AciI CCGC 2 cut(s) 88, 246
AcsI RAATTY 2 cut(s) 400, 823
AcyI GRCGYC 1 cut(s) 201
AfaI GTAC 1 cut(s) 554
AfiI CCNNNNNNNGG 3 cut(s) 223, 224, 564
AflIII ACRYGT 1 cut(s) 549
AgsI TTSAA 8 cut(s) 69, 377, 442, 463, 596, 655, 805, 899
AhdI GACNNNNNGTC 1 cut(s) 200
AleI CACNNNNGTG 1 cut(s) 248
AluBI AGCT 5 cut(s) 72, 144, 738, 760, 767
AluI AGCT 5 cut(s) 72, 144, 738, 760, 767
Alw26I GTCTC 1 cut(s) 606
AoxI GGCC 2 cut(s) 305, 662
ApeKI GCWGC 1 cut(s) 13
ApoI RAATTY 2 cut(s) 400, 823
AseI ATTAAT 1 cut(s) 639
AspLEI GCGC 2 cut(s) 844, 886
AspS9I GGNCC 1 cut(s) 306
AsuHPI GGTGA 4 cut(s) 16, 235, 718, 820
BbvI GCAGC 1 cut(s) 25
BccI CCATC 1 cut(s) 713
BceAI ACGGC 1 cut(s) 542
BcoDI GTCTC 1 cut(s) 606
BfaI CTAG 1 cut(s) 834
BfuAI ACCTGC 1 cut(s) 559
BisI GCNGC 1 cut(s) 14
BlsI GCNGC 1 cut(s) 15
BmeRI GACNNNNNGTC 1 cut(s) 200
BmgT120I GGNCC 1 cut(s) 306
BmrI ACTGGG 1 cut(s) 56
BmuI ACTGGG 1 cut(s) 56
BpmI CTGGAG 1 cut(s) 533
BsaHI GRCGYC 1 cut(s) 201
BsaI GGTCTC 1 cut(s) 606
BsaJI CCNNGG 1 cut(s) 729
Bsc4I CCNNNNNNNGG 3 cut(s) 223, 224, 564
Bse1I ACTGG 1 cut(s) 62
Bse3DI GCAATG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 729
BseGI GGATG 4 cut(s) 111, 260, 724, 856
BseLI CCNNNNNNNGG 3 cut(s) 223, 224, 564
BseMI GCAATG 1 cut(s) 126
BseMII CTCAG 2 cut(s) 491, 597
BseNI ACTGG 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 142
BseXI GCAGC 1 cut(s) 25
BshFI GGCC 2 cut(s) 307, 664
BsiSI CCGG 1 cut(s) 716
BslFI GGGAC 1 cut(s) 188
BslI CCNNNNNNNGG 3 cut(s) 223, 224, 564
BsmAI GTCTC 1 cut(s) 606
BsmFI GGGAC 1 cut(s) 188
BsnI GGCC 2 cut(s) 307, 664
Bso31I GGTCTC 1 cut(s) 606
Bsp19I CCATGG 1 cut(s) 729
BspACI CCGC 2 cut(s) 88, 246
BspANI GGCC 2 cut(s) 307, 664
BspCNI CTCAG 2 cut(s) 492, 598
BspMI ACCTGC 1 cut(s) 559
BspTNI GGTCTC 1 cut(s) 606
BsrDI GCAATG 1 cut(s) 126
BsrI ACTGG 1 cut(s) 62
BssECI CCNNGG 1 cut(s) 729
BssNI GRCGYC 1 cut(s) 201
BssT1I CCWWGG 1 cut(s) 729
BstACI GRCGYC 1 cut(s) 201
BstDEI CTNAG 3 cut(s) 453, 500, 606
BstDSI CCRYGG 1 cut(s) 729
BstF5I GGATG 4 cut(s) 111, 260, 724, 856
BstHHI GCGC 2 cut(s) 844, 886
BstMAI GTCTC 1 cut(s) 606
BstMWI GCNNNNNNNGC 2 cut(s) 10, 839
BstNSI RCATGY 1 cut(s) 553
BstV1I GCAGC 1 cut(s) 25
BsuRI GGCC 2 cut(s) 307, 664
BtgI CCRYGG 1 cut(s) 729
BtsCI GGATG 4 cut(s) 111, 260, 724, 856
BtsI GCAGTG 1 cut(s) 255
BtsIMutI CAGTG 1 cut(s) 255
BveI ACCTGC 1 cut(s) 559
CfoI GCGC 2 cut(s) 844, 886
Cfr13I GGNCC 1 cut(s) 306
CseI GACGC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 553
CviAII CATG 7 cut(s) 197, 321, 331, 550, 730, 791, 830
CviQI GTAC 1 cut(s) 553
DdeI CTNAG 3 cut(s) 453, 500, 606
DriI GACNNNNNGTC 1 cut(s) 200
Eam1105I GACNNNNNGTC 1 cut(s) 200
Eco130I CCWWGG 1 cut(s) 729
Eco147I AGGCCT 1 cut(s) 664
Eco31I GGTCTC 1 cut(s) 606
EcoRI GAATTC 2 cut(s) 400, 823
EcoT14I CCWWGG 1 cut(s) 729
EcoT22I ATGCAT 1 cut(s) 128
ErhI CCWWGG 1 cut(s) 729
FaeI CATG 7 cut(s) 200, 324, 334, 553, 733, 794, 833
FalI AAGNNNNNCTT 2 cut(s) 61, 93
FaqI GGGAC 1 cut(s) 188
FatI CATG 7 cut(s) 196, 320, 330, 549, 729, 790, 829
FauI CCCGC 1 cut(s) 95
Fnu4HI GCNGC 1 cut(s) 14
FokI GGATG 4 cut(s) 98, 247, 731, 863
Fsp4HI GCNGC 1 cut(s) 14
FspBI CTAG 1 cut(s) 834
GlaI GCGC 2 cut(s) 843, 885
GluI GCNGC 1 cut(s) 14
GsuI CTGGAG 1 cut(s) 533
HaeIII GGCC 2 cut(s) 307, 664
HapII CCGG 1 cut(s) 716
HgaI GACGC 1 cut(s) 190
HhaI GCGC 2 cut(s) 844, 886
Hin1I GRCGYC 1 cut(s) 201
Hin1II CATG 7 cut(s) 200, 324, 334, 553, 733, 794, 833
Hin6I GCGC 2 cut(s) 842, 884
HinP1I GCGC 2 cut(s) 842, 884
HindIII AAGCTT 1 cut(s) 70
HinfI GANTC 3 cut(s) 373, 515, 596
HpaII CCGG 1 cut(s) 716
HphI GGTGA 4 cut(s) 16, 235, 718, 820
Hpy166II GTNNAC 2 cut(s) 318, 726
Hpy188I TCNGA 3 cut(s) 501, 607, 678
Hpy188III TCNNGA 2 cut(s) 439, 848
Hpy8I GTNNAC 2 cut(s) 318, 726
HpyAV CCTTC 6 cut(s) 118, 193, 436, 654, 799, 883
HpyCH4V TGCA 4 cut(s) 126, 139, 581, 860
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 839
HpyF3I CTNAG 3 cut(s) 453, 500, 606
Hsp92I GRCGYC 1 cut(s) 201
Hsp92II CATG 7 cut(s) 200, 324, 334, 553, 733, 794, 833
HspAI GCGC 2 cut(s) 842, 884
LmnI GCTCC 2 cut(s) 9, 764
LpnPI CCDG 8 cut(s) 75, 149, 231, 381, 497, 554, 729, 833
Lsp1109I GCAGC 1 cut(s) 25
MaeI CTAG 1 cut(s) 834
MaeIII GTNAC 1 cut(s) 252
MboII GAAGA 2 cut(s) 232, 493
MluCI AATT 2 cut(s) 400, 823
MlyI GAGTC 1 cut(s) 524
MmeI TCCRAC 2 cut(s) 237, 794
Mph1103I ATGCAT 1 cut(s) 128
MseI TTAA 3 cut(s) 47, 531, 639
MslI CAYNNNNRTG 1 cut(s) 248
MspI CCGG 1 cut(s) 716
MwoI GCNNNNNNNGC 2 cut(s) 10, 839
NcoI CCATGG 1 cut(s) 729
NlaIII CATG 7 cut(s) 200, 324, 334, 553, 733, 794, 833
NmeAIII GCCGAG 2 cut(s) 373, 781
NmuCI GTSAC 1 cut(s) 252
NsiI ATGCAT 1 cut(s) 128
NspI RCATGY 1 cut(s) 553
OliI CACNNNNGTG 1 cut(s) 248
PaqCI CACCTGC 1 cut(s) 559
PceI AGGCCT 1 cut(s) 664
PciI ACATGT 1 cut(s) 549
PfeI GAWTC 2 cut(s) 373, 596
PkrI GCNGC 1 cut(s) 15
PleI GAGTC 1 cut(s) 523
PpsI GAGTC 1 cut(s) 523
PscI ACATGT 1 cut(s) 549
PshBI ATTAAT 1 cut(s) 639
PspPI GGNCC 1 cut(s) 306
RsaI GTAC 1 cut(s) 554
RsaNI GTAC 1 cut(s) 553
RseI CAYNNNNRTG 1 cut(s) 248
SaqAI TTAA 3 cut(s) 47, 531, 639
SatI GCNGC 1 cut(s) 14
Sau96I GGNCC 1 cut(s) 306
SchI GAGTC 1 cut(s) 524
SmiMI CAYNNNNRTG 1 cut(s) 248
Sse9I AATT 2 cut(s) 400, 823
SseBI AGGCCT 1 cut(s) 664
SsiI CCGC 2 cut(s) 88, 246
SspMI CTAG 1 cut(s) 834
StuI AGGCCT 1 cut(s) 664
StyI CCWWGG 1 cut(s) 729
TaqI TCGA 1 cut(s) 408
TasI AATT 2 cut(s) 400, 823
TfiI GAWTC 2 cut(s) 373, 596
Tru1I TTAA 3 cut(s) 47, 531, 639
Tru9I TTAA 3 cut(s) 47, 531, 639
TscAI CASTG 1 cut(s) 255
TseFI GTSAC 1 cut(s) 252
TseI GCWGC 1 cut(s) 13
Tsp45I GTSAC 1 cut(s) 252
TspDTI ATGAA 2 cut(s) 100, 779
TspGWI ACGGA 1 cut(s) 481
TspRI CASTG 1 cut(s) 255
VspI ATTAAT 1 cut(s) 639
XapI RAATTY 2 cut(s) 400, 823
XceI RCATGY 1 cut(s) 553
XcmI CCANNNNNNNNNTGG 1 cut(s) 220
XspI CTAG 1 cut(s) 834
Zsp2I ATGCAT 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.