Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8172878.1

Orthogroup ID

OG0006784

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 647

Gene Structure 647 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8172878.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 450 bp

gtaatcgttgaggtcccgaaggttaattgggaagatgttgggggtcagacggaggtgaagaatcaattgatagaagctgtaatgtggccccaaaagcaccaggacgaattcaagcgtataggaatttctcccccaacaggggtcctcatgtttggtcctcctggttgcagcaaaaccctcatggctcgtgcagtagcttctgaggcacggctgaatttcctttctgtgaagggtccagaactttatagcaaatgggttggtgaatctgagaaggctgtgagatcagtgtttgcaaaggcaagggctaatgccccagcaatcatattctttgatgaaattgacggtcttgctgccattcgtgggaaggaaaatgatggagtgtctgtttcagatagggtcataagtcaacttcttgtcgaaatggatggttggtggcaaaattattattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0016020 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0031976 GO:0031984 GO:0034357 GO:0042651 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044436 GO:0044444 GO:0044446 GO:0044464 GO:0055035

KEGG Pathways

Metabolic & Signaling

ko03008 map03008

Pfam Domains

Protein Families

AAA

Protein Analysis

149

Amino Acids

16.55

Weight (kDa)

5.49

Isoelectric Point (pI)

34.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006784)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G56690
fragaria_vesca	FvH4_6g32040 FvH4_6g32040 FvH4_6g32040 FvH4_6g32040 FvH4_6g32040
malus_domestica	MD09G1206200.v1.1
prunus_persica	Prupe.3G062600_v2.0.a1 Prupe.3G062600_v2.0.a1 Prupe.3G062600_v2.0.a1 Prupe.3G062600_v2.0.a1 Prupe.3G062600_v2.0.a1
pyrus_communis	pycom09g12300
rosa_chinensis	RchiOBHm_Chr2g0139701
rosa_laevigata	RLG00000019827
rosa_multiflora	Rmu_co8172878.1_g000001 Rmu_sc0009714.1_g000008
rosa_roxburghii	Rroxscaffold_2G00105270
rosa_rugosa	Rorug02G0359300 Rorug04G0364300 Rorug04G0364400
rosa_samantha	Rh2AG397600 Rh2AG409100 Rh2BG419400 Rh4CG452300
rosa_wichuraiana	Rw2G033460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	107, 123, 214
AfiI	CCNNNNNNNGG	4 cut(s)	137, 138, 139, 360
AgsI	TTSAA	1 cut(s)	112
AjnI	CCWGG	2 cut(s)	99, 160
AluBI	AGCT	2 cut(s)	77, 197
AluI	AGCT	2 cut(s)	77, 197
AoxI	GGCC	1 cut(s)	86
ApeKI	GCWGC	2 cut(s)	168, 350
ApoI	RAATTY	3 cut(s)	107, 123, 214
AspS9I	GGNCC	5 cut(s)	13, 87, 142, 155, 233
AsuHPI	GGTGA	2 cut(s)	67, 272
AvaII	GGWCC	4 cut(s)	13, 142, 155, 233
BauI	CACGAG	1 cut(s)	186
BbvI	GCAGC	2 cut(s)	180, 337
BccI	CCATC	2 cut(s)	368, 419
BceAI	ACGGC	1 cut(s)	224
BciT130I	CCWGG	2 cut(s)	101, 162
BisI	GCNGC	2 cut(s)	169, 351
BlsI	GCNGC	2 cut(s)	170, 352
Bme1390I	CCNGG	2 cut(s)	101, 162
Bme18I	GGWCC	4 cut(s)	13, 142, 155, 233
BmgT120I	GGNCC	5 cut(s)	13, 87, 142, 155, 233
BmiI	GGNNCC	4 cut(s)	15, 89, 143, 234
BmrFI	CCNGG	2 cut(s)	101, 162
BsaXI	ACNNNNNCTCC	2 cut(s)	369, 399
Bsc4I	CCNNNNNNNGG	4 cut(s)	137, 138, 139, 360
BseBI	CCWGG	2 cut(s)	101, 162
BseGI	GGATG	1 cut(s)	430
BseLI	CCNNNNNNNGG	4 cut(s)	137, 138, 139, 360
BseMII	CTCAG	2 cut(s)	192, 258
BseXI	GCAGC	2 cut(s)	180, 337
BseYI	CCCAGC	1 cut(s)	313
BsgI	GTGCAG	1 cut(s)	210
BshFI	GGCC	1 cut(s)	88
BslI	CCNNNNNNNGG	4 cut(s)	137, 138, 139, 360
BsnI	GGCC	1 cut(s)	88
Bsp143I	GATC	1 cut(s)	281
BspANI	GGCC	1 cut(s)	88
BspCNI	CTCAG	2 cut(s)	193, 259
BspLI	GGNNCC	4 cut(s)	15, 89, 143, 234
BssMI	GATC	1 cut(s)	281
BssSI	CACGAG	1 cut(s)	186
Bst2BI	CACGAG	1 cut(s)	186
Bst2UI	CCWGG	2 cut(s)	101, 162
Bst4CI	ACNGT	1 cut(s)	344
BstDEI	CTNAG	2 cut(s)	201, 267
BstF5I	GGATG	1 cut(s)	430
BstKTI	GATC	1 cut(s)	284
BstMBI	GATC	1 cut(s)	281
BstMWI	GCNNNNNNNGC	2 cut(s)	94, 203
BstNI	CCWGG	2 cut(s)	101, 162
BstSCI	CCNGG	2 cut(s)	99, 160
BstV1I	GCAGC	2 cut(s)	180, 337
BsuRI	GGCC	1 cut(s)	88
BtsCI	GGATG	1 cut(s)	430
BtsIMutI	CAGTG	1 cut(s)	291
Cfr13I	GGNCC	5 cut(s)	13, 87, 142, 155, 233
CviAII	CATG	2 cut(s)	148, 181
CviJI	RGCY	7 cut(s)	77, 88, 185, 197, 211, 275, 305
CviKI_1	RGCY	7 cut(s)	77, 88, 185, 197, 211, 275, 305
DdeI	CTNAG	2 cut(s)	201, 267
DpnI	GATC	1 cut(s)	283
DpnII	GATC	1 cut(s)	281
Eco47I	GGWCC	4 cut(s)	13, 142, 155, 233
EcoO109I	RGGNCCY	2 cut(s)	13, 142
EcoRI	GAATTC	1 cut(s)	107
EcoRII	CCWGG	2 cut(s)	99, 160
FaeI	CATG	2 cut(s)	151, 184
FaiI	YATR	6 cut(s)	119, 149, 182, 246, 323, 401
FatI	CATG	2 cut(s)	147, 180
Fnu4HI	GCNGC	2 cut(s)	169, 351
FokI	GGATG	1 cut(s)	437
Fsp4HI	GCNGC	2 cut(s)	169, 351
GluI	GCNGC	2 cut(s)	169, 351
GsaI	CCCAGC	1 cut(s)	317
HaeIII	GGCC	1 cut(s)	88
Hin1II	CATG	2 cut(s)	151, 184
HincII	GTYRAC	1 cut(s)	407
HindII	GTYRAC	1 cut(s)	407
HinfI	GANTC	2 cut(s)	61, 263
HphI	GGTGA	2 cut(s)	67, 272
Hpy166II	GTNNAC	1 cut(s)	407
Hpy188I	TCNGA	4 cut(s)	48, 202, 268, 391
Hpy188III	TCNNGA	2 cut(s)	16, 236
Hpy8I	GTNNAC	1 cut(s)	407
HpyAV	CCTTC	4 cut(s)	13, 223, 265, 358
HpyCH4III	ACNGT	1 cut(s)	344
HpyCH4V	TGCA	3 cut(s)	168, 191, 293
HpyF10VI	GCNNNNNNNGC	2 cut(s)	94, 203
HpyF3I	CTNAG	2 cut(s)	201, 267
Hsp92II	CATG	2 cut(s)	151, 184
Kzo9I	GATC	1 cut(s)	281
LpnPI	CCDG	7 cut(s)	86, 113, 123, 147, 174, 249, 327
Lsp1109I	GCAGC	2 cut(s)	180, 337
MalI	GATC	1 cut(s)	283
MboI	GATC	1 cut(s)	281
MboII	GAAGA	2 cut(s)	44, 70
MfeI	CAATTG	1 cut(s)	65
MluCI	AATT	7 cut(s)	25, 65, 107, 123, 214, 336, 439
MnlI	CCTC	6 cut(s)	4, 46, 155, 168, 188, 196
MseI	TTAA	1 cut(s)	24
MspR9I	CCNGG	2 cut(s)	101, 162
MunI	CAATTG	1 cut(s)	65
MvaI	CCWGG	2 cut(s)	101, 162
MwoI	GCNNNNNNNGC	2 cut(s)	94, 203
NdeII	GATC	1 cut(s)	281
NlaIII	CATG	2 cut(s)	151, 184
NlaIV	GGNNCC	4 cut(s)	15, 89, 143, 234
PfeI	GAWTC	2 cut(s)	61, 263
PkrI	GCNGC	2 cut(s)	170, 352
PpuMI	RGGWCCY	2 cut(s)	13, 142
Psp5II	RGGWCCY	2 cut(s)	13, 142
Psp6I	CCWGG	2 cut(s)	99, 160
PspFI	CCCAGC	1 cut(s)	313
PspGI	CCWGG	2 cut(s)	99, 160
PspN4I	GGNNCC	4 cut(s)	15, 89, 143, 234
PspPI	GGNCC	5 cut(s)	13, 87, 142, 155, 233
PspPPI	RGGWCCY	2 cut(s)	13, 142
SaqAI	TTAA	1 cut(s)	24
SatI	GCNGC	2 cut(s)	169, 351
Sau3AI	GATC	1 cut(s)	281
Sau96I	GGNCC	5 cut(s)	13, 87, 142, 155, 233
ScrFI	CCNGG	2 cut(s)	101, 162
SetI	ASST	5 cut(s)	15, 24, 57, 79, 199
SinI	GGWCC	4 cut(s)	13, 142, 155, 233
Sse9I	AATT	7 cut(s)	25, 65, 107, 123, 214, 336, 439
StyD4I	CCNGG	2 cut(s)	99, 160
TaaI	ACNGT	1 cut(s)	344
TaqI	TCGA	1 cut(s)	417
TasI	AATT	7 cut(s)	25, 65, 107, 123, 214, 336, 439
TfiI	GAWTC	2 cut(s)	61, 263
Tru1I	TTAA	1 cut(s)	24
Tru9I	TTAA	1 cut(s)	24
TscAI	CASTG	1 cut(s)	291
TseI	GCWGC	2 cut(s)	168, 350
TspDTI	ATGAA	1 cut(s)	348
TspGWI	ACGGA	1 cut(s)	65
TspRI	CASTG	1 cut(s)	291
VpaK11BI	GGWCC	4 cut(s)	13, 142, 155, 233
XapI	RAATTY	3 cut(s)	107, 123, 214

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.