Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8213396.1

Orthogroup ID

OG0007577

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 692

Gene Structure 692 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8213396.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 352 bp

atggatttgctgggtcctagtcttgaagacttatttaacttctgcagtaggaaactttctttgaaaacagttcttatgctggcagatcaaatgatcaatcgtgttgaatttgttcattccaaatcctttcttcatcgtgatatcaagccagacaattttctcatgggattaggaaggcgtgcaaatcaggtatacatgattgattttggtctggctaagaaatatcgggatagtacaacccgtcaacatattccatatagagaaaacaagaatctgactggaacagcaagatatgcaagcatgaacacccaccttgggattggtatgtttcaatccttccttttgtattttg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005911 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006810 GO:0006897 GO:0008150 GO:0008152 GO:0008360 GO:0009506 GO:0009987 GO:0016192 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0018105 GO:0018193 GO:0018209 GO:0019538 GO:0022603 GO:0022604 GO:0030054 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0050789 GO:0050793 GO:0050794 GO:0051128 GO:0051179 GO:0051234 GO:0055044 GO:0065007 GO:0065008 GO:0071704 GO:0098657 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04011 ko04392 map04011 map04392

Pfam Domains

Protein Families

Pkinase

Protein Analysis

117

Amino Acids

13.66

Weight (kDa)

9.72

Isoelectric Point (pI)

22.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007577)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G26100 AT5G57015
fragaria_vesca	FvH4_1g07860 FvH4_1g07860
malus_domestica	MD02G1082400.v1.1 MD15G1210300.v1.1
prunus_persica	Prupe.3G046000_v2.0.a1 Prupe.7G206400_v2.0.a1
pyrus_communis	pycom02g06530 pycom15g18640
rosa_chinensis	RchiOBHm_Chr2g0093731
rosa_laevigata	RLG00000016433 RLG00000034433
rosa_multiflora	Rmu_co8213396.1_g000001 Rmu_co8410961.1_g000001 Rmu_sc0002126.1_g000006
rosa_roxburghii	Rroxscaffold_2G00147840
rosa_rugosa	Rorug02G0039400
rosa_samantha	Rh2AG086000 Rh2BG086100 Rh2CG088500 Rh2DG084100 Rh2DG455700 Rh5DG001800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	192
AcsI	RAATTY	1 cut(s)	107
AfaI	GTAC	1 cut(s)	235
AfiI	CCNNNNNNNGG	1 cut(s)	315
AgsI	TTSAA	4 cut(s)	26, 64, 107, 332
ApoI	RAATTY	1 cut(s)	107
Asp700I	GAANNNNTTC	1 cut(s)	111
AspS9I	GGNCC	1 cut(s)	14
AvaII	GGWCC	1 cut(s)	14
BbsI	GAAGAC	1 cut(s)	33
BclI	TGATCA	1 cut(s)	93
BfaI	CTAG	1 cut(s)	18
BfmI	CTRYAG	1 cut(s)	43
Bme18I	GGWCC	1 cut(s)	14
BmgT120I	GGNCC	1 cut(s)	14
BmiI	GGNNCC	1 cut(s)	15
BpiI	GAAGAC	1 cut(s)	33
BsaJI	CCNNGG	1 cut(s)	313
Bsc4I	CCNNNNNNNGG	1 cut(s)	315
Bse1I	ACTGG	1 cut(s)	283
BseDI	CCNNGG	1 cut(s)	313
BseLI	CCNNNNNNNGG	1 cut(s)	315
BseNI	ACTGG	1 cut(s)	283
BseYI	CCCAGC	1 cut(s)	10
BslI	CCNNNNNNNGG	1 cut(s)	315
Bsp143I	GATC	2 cut(s)	85, 93
BspLI	GGNNCC	1 cut(s)	15
BspMAI	CTGCAG	1 cut(s)	47
BsrI	ACTGG	1 cut(s)	283
BssECI	CCNNGG	1 cut(s)	313
BssMI	GATC	2 cut(s)	85, 93
BssNAI	GTATAC	1 cut(s)	193
BssT1I	CCWWGG	1 cut(s)	313
Bst1107I	GTATAC	1 cut(s)	193
Bst4CI	ACNGT	1 cut(s)	70
BstAPI	GCANNNNNTGC	1 cut(s)	293
BstC8I	GCNNGC	3 cut(s)	81, 180, 298
BstDEI	CTNAG	1 cut(s)	216
BstKTI	GATC	2 cut(s)	88, 96
BstMBI	GATC	2 cut(s)	85, 93
BstMWI	GCNNNNNNNGC	1 cut(s)	293
BstSFI	CTRYAG	1 cut(s)	43
BstV2I	GAAGAC	1 cut(s)	33
BstZ17I	GTATAC	1 cut(s)	193
Cac8I	GCNNGC	3 cut(s)	81, 180, 298
Cfr13I	GGNCC	1 cut(s)	14
Csp6I	GTAC	1 cut(s)	234
CviAII	CATG	3 cut(s)	163, 196, 301
CviJI	RGCY	2 cut(s)	148, 215
CviKI_1	RGCY	2 cut(s)	148, 215
CviQI	GTAC	1 cut(s)	234
DdeI	CTNAG	1 cut(s)	216
DpnI	GATC	2 cut(s)	87, 95
DpnII	GATC	2 cut(s)	85, 93
Eco130I	CCWWGG	1 cut(s)	313
Eco32I	GATATC	1 cut(s)	142
Eco47I	GGWCC	1 cut(s)	14
EcoO109I	RGGNCCY	1 cut(s)	14
EcoRV	GATATC	1 cut(s)	142
EcoT14I	CCWWGG	1 cut(s)	313
ErhI	CCWWGG	1 cut(s)	313
FaeI	CATG	3 cut(s)	166, 199, 304
FatI	CATG	3 cut(s)	162, 195, 300
FbaI	TGATCA	1 cut(s)	93
FblI	GTMKAC	1 cut(s)	192
FspBI	CTAG	1 cut(s)	18
GsaI	CCCAGC	1 cut(s)	14
Hin1II	CATG	3 cut(s)	166, 199, 304
HincII	GTYRAC	1 cut(s)	245
HindII	GTYRAC	1 cut(s)	245
HinfI	GANTC	1 cut(s)	271
Hpy166II	GTNNAC	2 cut(s)	193, 245
Hpy188I	TCNGA	1 cut(s)	276
Hpy188III	TCNNGA	3 cut(s)	23, 137, 227
Hpy8I	GTNNAC	2 cut(s)	193, 245
HpyAV	CCTTC	2 cut(s)	168, 346
HpyCH4III	ACNGT	1 cut(s)	70
HpyCH4V	TGCA	3 cut(s)	45, 182, 296
HpyF10VI	GCNNNNNNNGC	1 cut(s)	293
HpyF3I	CTNAG	1 cut(s)	216
Hsp92II	CATG	3 cut(s)	166, 199, 304
Ksp22I	TGATCA	1 cut(s)	93
Kzo9I	GATC	2 cut(s)	85, 93
LpnPI	CCDG	5 cut(s)	65, 162, 173, 197, 264
MaeI	CTAG	1 cut(s)	18
MalI	GATC	2 cut(s)	87, 95
MboI	GATC	2 cut(s)	85, 93
MboII	GAAGA	2 cut(s)	38, 122
MluCI	AATT	2 cut(s)	107, 154
MroXI	GAANNNNTTC	1 cut(s)	111
MseI	TTAA	1 cut(s)	36
MwoI	GCNNNNNNNGC	1 cut(s)	293
NdeII	GATC	2 cut(s)	85, 93
NlaIII	CATG	3 cut(s)	166, 199, 304
NlaIV	GGNNCC	1 cut(s)	15
PdmI	GAANNNNTTC	1 cut(s)	111
PfeI	GAWTC	1 cut(s)	271
PpuMI	RGGWCCY	1 cut(s)	14
Psp5II	RGGWCCY	1 cut(s)	14
PspFI	CCCAGC	1 cut(s)	10
PspN4I	GGNNCC	1 cut(s)	15
PspPI	GGNCC	1 cut(s)	14
PspPPI	RGGWCCY	1 cut(s)	14
PstI	CTGCAG	1 cut(s)	47
RsaI	GTAC	1 cut(s)	235
RsaNI	GTAC	1 cut(s)	234
SaqAI	TTAA	1 cut(s)	36
Sau3AI	GATC	2 cut(s)	85, 93
Sau96I	GGNCC	1 cut(s)	14
SetI	ASST	2 cut(s)	192, 315
SfcI	CTRYAG	1 cut(s)	43
SinI	GGWCC	1 cut(s)	14
Sse9I	AATT	2 cut(s)	107, 154
SspMI	CTAG	1 cut(s)	18
StyI	CCWWGG	1 cut(s)	313
TaaI	ACNGT	1 cut(s)	70
TasI	AATT	2 cut(s)	107, 154
TatI	WGTACW	1 cut(s)	233
TfiI	GAWTC	1 cut(s)	271
Tru1I	TTAA	1 cut(s)	36
Tru9I	TTAA	1 cut(s)	36
TspDTI	ATGAA	3 cut(s)	104, 122, 317
VpaK11BI	GGWCC	1 cut(s)	14
XapI	RAATTY	1 cut(s)	107
XcmI	CCANNNNNNNNNTGG	1 cut(s)	317
XmiI	GTMKAC	1 cut(s)	192
XmnI	GAANNNNTTC	1 cut(s)	111
XspI	CTAG	1 cut(s)	18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.