Rh5DG001800
ERF Family

belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
131794 .. 132759
966 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG001800.1

Sequence Viewer

Length: 282 bp
ATGGTTTATGAGTTTATGGTTTCCAATTTTGAGGAAAATGTGAAGACAAAACATCCTCAGTTGCTGTATGAATCCAAGTTGTATAGGATCCTACAAGGAGGAACTGGGATACCAAATGTGCGGTGGTTTGGAGTTGAAGGAGATTATAACGTTTTGGTAATGGATTTGCTGGGTCCTAGTCTTGAAGACTTATTTAACTTCTGTAGTAGGAAACTTTCTTTGGAGACACTTATGCTGGCAGAAGACAGTTATGCTGGCAGATCAAATGGTATACATGATTGA

Protein Analysis

93

Amino Acids

10.65

Weight (kDa)

4.88

Isoelectric Point (pI)

34.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 147
AccI GTMKAC 1 cut(s) 271
AciI CCGC 1 cut(s) 121
AclI AACGTT 1 cut(s) 150
AclWI GGATC 2 cut(s) 82, 95
AgsI TTSAA 2 cut(s) 137, 185
AjuI GAANNNNNNNTTGG 2 cut(s) 203, 235
Alw26I GTCTC 1 cut(s) 218
AlwI GGATC 2 cut(s) 82, 95
AlwNI CAGNNNCTG 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 173
AvaII GGWCC 1 cut(s) 173
BamHI GGATCC 1 cut(s) 87
BbsI GAAGAC 3 cut(s) 50, 192, 249
BciVI GTATCC 1 cut(s) 102
BcoDI GTCTC 1 cut(s) 218
BfaI CTAG 1 cut(s) 177
BfmI CTRYAG 1 cut(s) 202
BfuI GTATCC 1 cut(s) 102
Bme18I GGWCC 1 cut(s) 173
BmgT120I GGNCC 1 cut(s) 173
BmiI GGNNCC 2 cut(s) 89, 174
BmrI ACTGGG 1 cut(s) 114
BmuI ACTGGG 1 cut(s) 114
BpiI GAAGAC 3 cut(s) 50, 192, 249
Bse1I ACTGG 1 cut(s) 109
BseGI GGATG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 109
BseYI CCCAGC 1 cut(s) 169
BsmAI GTCTC 1 cut(s) 218
Bsp143I GATC 2 cut(s) 87, 260
BspACI CCGC 1 cut(s) 121
BspCNI CTCAG 1 cut(s) 70
BspLI GGNNCC 2 cut(s) 89, 174
BspPI GGATC 2 cut(s) 82, 95
BsrI ACTGG 1 cut(s) 109
BssMI GATC 2 cut(s) 87, 260
BssNAI GTATAC 1 cut(s) 272
Bst1107I GTATAC 1 cut(s) 272
Bst4CI ACNGT 1 cut(s) 248
BstC8I GCNNGC 2 cut(s) 237, 256
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 2 cut(s) 90, 263
BstMAI GTCTC 1 cut(s) 218
BstMBI GATC 2 cut(s) 87, 260
BstSFI CTRYAG 1 cut(s) 202
BstV2I GAAGAC 3 cut(s) 50, 192, 249
BstX2I RGATCY 1 cut(s) 87
BstYI RGATCY 1 cut(s) 87
BstZ17I GTATAC 1 cut(s) 272
BsuI GTATCC 1 cut(s) 102
BtsCI GGATG 1 cut(s) 52
Cac8I GCNNGC 2 cut(s) 237, 256
CaiI CAGNNNCTG 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 173
CviAII CATG 1 cut(s) 275
DdeI CTNAG 1 cut(s) 57
DpnI GATC 2 cut(s) 89, 262
DpnII GATC 2 cut(s) 87, 260
Eco47I GGWCC 1 cut(s) 173
EcoO109I RGGNCCY 1 cut(s) 173
FaeI CATG 1 cut(s) 278
FaiI YATR 9 cut(s) 9, 17, 69, 84, 147, 233, 252, 272, 276
FatI CATG 1 cut(s) 274
FblI GTMKAC 1 cut(s) 271
FokI GGATG 1 cut(s) 39
FspBI CTAG 1 cut(s) 177
GsaI CCCAGC 1 cut(s) 173
Hin1II CATG 1 cut(s) 278
HinfI GANTC 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 272
Hpy188III TCNNGA 1 cut(s) 182
Hpy8I GTNNAC 1 cut(s) 272
HpyAV CCTTC 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4IV ACGT 1 cut(s) 150
HpyF3I CTNAG 1 cut(s) 57
HpySE526I ACGT 1 cut(s) 150
Hsp92II CATG 1 cut(s) 278
Kzo9I GATC 2 cut(s) 87, 260
LpnPI CCDG 4 cut(s) 90, 155, 221, 240
MaeI CTAG 1 cut(s) 177
MaeII ACGT 1 cut(s) 150
MalI GATC 2 cut(s) 89, 262
MboI GATC 2 cut(s) 87, 260
MboII GAAGA 3 cut(s) 55, 197, 254
MflI RGATCY 1 cut(s) 87
MluCI AATT 1 cut(s) 25
MnlI CCTC 3 cut(s) 25, 66, 92
MseI TTAA 1 cut(s) 195
NdeII GATC 2 cut(s) 87, 260
NlaIII CATG 1 cut(s) 278
NlaIV GGNNCC 2 cut(s) 89, 174
PfeI GAWTC 1 cut(s) 71
PpuMI RGGWCCY 1 cut(s) 173
PsiI TTATAA 1 cut(s) 147
Psp1406I AACGTT 1 cut(s) 150
Psp5II RGGWCCY 1 cut(s) 173
PspFI CCCAGC 1 cut(s) 169
PspN4I GGNNCC 2 cut(s) 89, 174
PspPI GGNCC 1 cut(s) 173
PspPPI RGGWCCY 1 cut(s) 173
PstNI CAGNNNCTG 1 cut(s) 64
PsuI RGATCY 1 cut(s) 87
SaqAI TTAA 1 cut(s) 195
Sau3AI GATC 2 cut(s) 87, 260
Sau96I GGNCC 1 cut(s) 173
SetI ASST 1 cut(s) 153
SfcI CTRYAG 1 cut(s) 202
SgeI CNNG 8 cut(s) 88, 107, 117, 182, 189, 194, 248, 267
SinI GGWCC 1 cut(s) 173
Sse9I AATT 1 cut(s) 25
SsiI CCGC 1 cut(s) 121
SspMI CTAG 1 cut(s) 177
TaaI ACNGT 1 cut(s) 248
TaiI ACGT 1 cut(s) 153
TasI AATT 1 cut(s) 25
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TspDTI ATGAA 1 cut(s) 84
VpaK11BI GGWCC 1 cut(s) 173
XcmI CCANNNNNNNNNTGG 1 cut(s) 120
XmiI GTMKAC 1 cut(s) 271
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.