Rmu_co8219898.1_g000001

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8219898.1
Physical Location & Seq
Forward (+)
1 .. 738
738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8219898.1_g000001.1.cds

Sequence Viewer

Length: 370 bp
gatagcagaatcggtcgatcttgctcttcagctttctgagacatacaaggttcgtgttgtggagtttggacatgcactggtcttgttctttttcagtatcatcatcagcttaattgatagcacattggatgattgggggttgaagacatctcgaaagagaccaagattagcttttggaggttcaagtgaccatgatggtgggatagattctataggaaatgagaagtttataagtaacgaacatcaggaaaggattaggacaatgaattcttttttggccatagaggtgctgggaaagctgacagaaagcagaaaagctttggttctgcttcgccttgttcacttgaatatgtatgttttccattcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

13.79

Weight (kDa)

6.57

Isoelectric Point (pI)

34.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 231
AcoI YGGCCR 1 cut(s) 277
AcsI RAATTY 1 cut(s) 266
AcuI CTGAAG 1 cut(s) 12
AgsI TTSAA 3 cut(s) 143, 184, 347
AjuI GAANNNNNNNTTGG 2 cut(s) 258, 290
AluBI AGCT 5 cut(s) 32, 109, 171, 299, 318
AluI AGCT 5 cut(s) 32, 109, 171, 299, 318
Alw26I GTCTC 2 cut(s) 33, 152
AoxI GGCC 1 cut(s) 277
ApoI RAATTY 1 cut(s) 266
BalI TGGCCA 1 cut(s) 279
BbsI GAAGAC 1 cut(s) 150
BccI CCATC 1 cut(s) 189
BcoDI GTCTC 2 cut(s) 33, 152
BfmI CTRYAG 1 cut(s) 211
BpiI GAAGAC 1 cut(s) 150
BsaI GGTCTC 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 82
BseGI GGATG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 28
BseNI ACTGG 1 cut(s) 82
BseYI CCCAGC 1 cut(s) 290
Bsh1285I CGRYCG 1 cut(s) 16
BshFI GGCC 1 cut(s) 279
BsiEI CGRYCG 1 cut(s) 16
BsmAI GTCTC 2 cut(s) 33, 152
BsnI GGCC 1 cut(s) 279
Bso31I GGTCTC 1 cut(s) 152
Bsp143I GATC 1 cut(s) 17
BspANI GGCC 1 cut(s) 279
BspCNI CTCAG 1 cut(s) 29
BspQI GCTCTTC 1 cut(s) 31
BspTNI GGTCTC 1 cut(s) 152
BsrI ACTGG 1 cut(s) 82
BssMI GATC 1 cut(s) 17
Bst6I CTCTTC 1 cut(s) 31
BstDEI CTNAG 1 cut(s) 37
BstF5I GGATG 1 cut(s) 134
BstKTI GATC 1 cut(s) 20
BstMAI GTCTC 2 cut(s) 33, 152
BstMBI GATC 1 cut(s) 17
BstMCI CGRYCG 1 cut(s) 16
BstMWI GCNNNNNNNGC 1 cut(s) 296
BstNSI RCATGY 1 cut(s) 75
BstSFI CTRYAG 1 cut(s) 211
BstV2I GAAGAC 1 cut(s) 150
BstXI CCANNNNNNTGG 1 cut(s) 198
BsuRI GGCC 1 cut(s) 279
BtsCI GGATG 1 cut(s) 134
BtsIMutI CAGTG 1 cut(s) 75
CviAII CATG 2 cut(s) 72, 192
CviJI RGCY 6 cut(s) 32, 109, 171, 279, 299, 318
CviKI_1 RGCY 6 cut(s) 32, 109, 171, 279, 299, 318
DdeI CTNAG 1 cut(s) 37
DpnI GATC 1 cut(s) 19
DpnII GATC 1 cut(s) 17
EaeI YGGCCR 1 cut(s) 277
Eam1104I CTCTTC 1 cut(s) 31
EarI CTCTTC 1 cut(s) 31
Eco31I GGTCTC 1 cut(s) 152
Eco57I CTGAAG 1 cut(s) 12
EcoRI GAATTC 1 cut(s) 266
FaeI CATG 2 cut(s) 75, 195
FaiI YATR 8 cut(s) 44, 73, 193, 213, 231, 282, 351, 355
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FatI CATG 2 cut(s) 71, 191
FokI GGATG 1 cut(s) 141
GsaI CCCAGC 1 cut(s) 294
HaeIII GGCC 1 cut(s) 279
Hin1II CATG 2 cut(s) 75, 195
HindIII AAGCTT 1 cut(s) 316
HinfI GANTC 2 cut(s) 9, 207
Hpy166II GTNNAC 1 cut(s) 341
Hpy188I TCNGA 1 cut(s) 38
Hpy188III TCNNGA 2 cut(s) 151, 246
Hpy8I GTNNAC 1 cut(s) 341
HpyCH4V TGCA 1 cut(s) 75
HpyF10VI GCNNNNNNNGC 1 cut(s) 296
HpyF3I CTNAG 1 cut(s) 37
Hsp92II CATG 2 cut(s) 75, 195
Kzo9I GATC 1 cut(s) 17
LguI GCTCTTC 1 cut(s) 31
LpnPI CCDG 3 cut(s) 63, 231, 276
MaeIII GTNAC 2 cut(s) 186, 234
MalI GATC 1 cut(s) 19
MboI GATC 1 cut(s) 17
MboII GAAGA 2 cut(s) 18, 155
MlsI TGGCCA 1 cut(s) 279
MluCI AATT 2 cut(s) 112, 266
MluNI TGGCCA 1 cut(s) 279
MnlI CCTC 2 cut(s) 171, 278
Mox20I TGGCCA 1 cut(s) 279
MscI TGGCCA 1 cut(s) 279
MseI TTAA 2 cut(s) 111, 368
MslI CAYNNNNRTG 2 cut(s) 196, 285
Msp20I TGGCCA 1 cut(s) 279
MwoI GCNNNNNNNGC 1 cut(s) 296
NdeII GATC 1 cut(s) 17
NlaIII CATG 2 cut(s) 75, 195
NmuCI GTSAC 1 cut(s) 186
NspI RCATGY 1 cut(s) 75
PciSI GCTCTTC 1 cut(s) 31
PfeI GAWTC 2 cut(s) 9, 207
PsiI TTATAA 1 cut(s) 231
PspFI CCCAGC 1 cut(s) 290
RseI CAYNNNNRTG 2 cut(s) 196, 285
SapI GCTCTTC 1 cut(s) 31
SaqAI TTAA 2 cut(s) 111, 368
Sau3AI GATC 1 cut(s) 17
SetI ASST 8 cut(s) 34, 52, 111, 173, 182, 289, 301, 320
SfcI CTRYAG 1 cut(s) 211
SmiMI CAYNNNNRTG 2 cut(s) 196, 285
Sse9I AATT 2 cut(s) 112, 266
TaqI TCGA 2 cut(s) 16, 152
TasI AATT 2 cut(s) 112, 266
TfiI GAWTC 2 cut(s) 9, 207
Tru1I TTAA 2 cut(s) 111, 368
Tru9I TTAA 2 cut(s) 111, 368
TscAI CASTG 1 cut(s) 82
TseFI GTSAC 1 cut(s) 186
Tsp45I GTSAC 1 cut(s) 186
TspDTI ATGAA 1 cut(s) 279
TspRI CASTG 1 cut(s) 82
XapI RAATTY 1 cut(s) 266
XceI RCATGY 1 cut(s) 75
XcmI CCANNNNNNNNNTGG 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.