Rmu_co8224982.1_g000001

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8224982.1
OG0015659
Physical Location & Seq
Forward (+)
82 .. 690
609 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8224982.1_g000001.1.cds

Sequence Viewer

Length: 609 bp
atgaaggaagaaggttttgctcctgatggaattacgttgttggctgttcttcaagcttgcagttactctggattatgggaaactgggttacgcttattcaacgaaatggagccaaaatatgggactaggtccgtgattgagcactttggttgcatggtcgatcttttgggtcgggctgggaaattttcagaagccatcgatttcatcaacacaagtccatttccagactcaccgatgctttggagaactttagtcaatgtctgcatgttatgtgggaatttaaattttggcattttagcttcaaagcatttgcttgagttggaacctgatgaggctgggtcatatatacttgtttcaaatatgtatgctggaggaggaatgtttgatgaggctgcaaaagttagaactgtaatgaatgacttgaaagtaaacaaagaagcaggttgcagctggattgaagtagataataagtttcattattttgtggcaagtgatatggaccatccgaaaagcgatgaaatttatcagaagttgaatctcttgaagattcaaataaaactgaacagtcatgatagaagtgatctctgtctggctgcagatcctttataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2

Protein Analysis

202

Amino Acids

22.55

Weight (kDa)

4.9

Isoelectric Point (pI)

41.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015659)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g23520
malus_domestica MD12G1072400.v1.1 MD14G1069600.v1.1
pyrus_communis pycom12g06080 pycom14g05770
rosa_chinensis RchiOBHm_Chr3g0481521
rosa_laevigata RLG00000023390
rosa_multiflora Rmu_co8224982.1_g000001 Rmu_sc0010846.1_g000006
rosa_roxburghii Rroxscaffold_6G00400370
rosa_rugosa Rorug03G0192400
rosa_samantha Rh3AG243600 Rh3BG278500 Rh3CG273700 Rh3DG270500
rosa_wichuraiana Rw3G021760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 607
Acc36I ACCTGC 1 cut(s) 431
AccB7I CCANNNNNTGG 1 cut(s) 119
AclWI GGATC 1 cut(s) 593
AcsI RAATTY 4 cut(s) 182, 277, 283, 519
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 9 cut(s) 53, 100, 303, 357, 424, 458, 535, 544, 551
AluBI AGCT 3 cut(s) 56, 299, 450
AluI AGCT 3 cut(s) 56, 299, 450
Alw21I GWGCWC 1 cut(s) 144
AlwI GGATC 1 cut(s) 593
ApeKI GCWGC 3 cut(s) 392, 447, 593
ApoI RAATTY 4 cut(s) 182, 277, 283, 519
AspS9I GGNCC 2 cut(s) 129, 499
AsuHPI GGTGA 1 cut(s) 222
AvaII GGWCC 2 cut(s) 129, 499
Bbv12I GWGCWC 1 cut(s) 144
BbvI GCAGC 3 cut(s) 379, 459, 580
BccI CCATC 3 cut(s) 20, 203, 510
BfaI CTAG 1 cut(s) 126
BfmI CTRYAG 1 cut(s) 594
BfuAI ACCTGC 1 cut(s) 431
BisI GCNGC 3 cut(s) 393, 448, 594
BlsI GCNGC 3 cut(s) 394, 449, 595
Bme18I GGWCC 2 cut(s) 129, 499
BmgT120I GGNCC 2 cut(s) 129, 499
BmiI GGNNCC 2 cut(s) 111, 324
BmrI ACTGGG 1 cut(s) 93
BmsI GCATC 1 cut(s) 225
BmuI ACTGGG 1 cut(s) 93
BpmI CTGGAG 1 cut(s) 390
BpuEI CTTGAG 1 cut(s) 335
Bsa29I ATCGAT 1 cut(s) 198
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 88
BseCI ATCGAT 1 cut(s) 198
BseGI GGATG 1 cut(s) 502
BseLI CCNNNNNNNGG 1 cut(s) 119
BseNI ACTGG 1 cut(s) 88
BseRI GAGGAG 1 cut(s) 387
BseXI GCAGC 3 cut(s) 379, 459, 580
BseYI CCCAGC 2 cut(s) 176, 335
BshVI ATCGAT 1 cut(s) 198
BsiHKAI GWGCWC 1 cut(s) 144
BslFI GGGAC 1 cut(s) 136
BslI CCNNNNNNNGG 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 136
Bsp1286I GDGCHC 1 cut(s) 144
Bsp143I GATC 3 cut(s) 160, 580, 598
BspDI ATCGAT 1 cut(s) 198
BspHI TCATGA 1 cut(s) 568
BspLI GGNNCC 2 cut(s) 111, 324
BspMAI CTGCAG 1 cut(s) 598
BspMI ACCTGC 1 cut(s) 431
BspPI GGATC 1 cut(s) 593
BsrI ACTGG 1 cut(s) 88
BssMI GATC 3 cut(s) 160, 580, 598
Bst4CI ACNGT 2 cut(s) 409, 566
BstC8I GCNNGC 1 cut(s) 58
BstF5I GGATG 1 cut(s) 502
BstKTI GATC 3 cut(s) 163, 583, 601
BstMBI GATC 3 cut(s) 160, 580, 598
BstNSI RCATGY 1 cut(s) 268
BstSFI CTRYAG 1 cut(s) 594
BstV1I GCAGC 3 cut(s) 379, 459, 580
BstX2I RGATCY 1 cut(s) 598
BstYI RGATCY 1 cut(s) 598
Bsu15I ATCGAT 1 cut(s) 198
BsuTUI ATCGAT 1 cut(s) 198
BtgZI GCGATG 1 cut(s) 528
BtsCI GGATG 1 cut(s) 502
BveI ACCTGC 1 cut(s) 431
Cac8I GCNNGC 1 cut(s) 58
CciI TCATGA 1 cut(s) 568
Cfr13I GGNCC 2 cut(s) 129, 499
ClaI ATCGAT 1 cut(s) 198
CviAII CATG 3 cut(s) 154, 265, 569
DpnI GATC 3 cut(s) 162, 582, 600
DpnII GATC 3 cut(s) 160, 580, 598
DraI TTTAAA 1 cut(s) 282
Eco47I GGWCC 2 cut(s) 129, 499
FaeI CATG 3 cut(s) 157, 268, 572
FaqI GGGAC 1 cut(s) 136
FatI CATG 3 cut(s) 153, 264, 568
Fnu4HI GCNGC 3 cut(s) 393, 448, 594
FokI GGATG 1 cut(s) 489
Fsp4HI GCNGC 3 cut(s) 393, 448, 594
FspBI CTAG 1 cut(s) 126
GluI GCNGC 3 cut(s) 393, 448, 594
GsaI CCCAGC 2 cut(s) 180, 339
GsuI CTGGAG 1 cut(s) 390
Hin1II CATG 3 cut(s) 157, 268, 572
HindIII AAGCTT 1 cut(s) 54
HinfI GANTC 3 cut(s) 227, 535, 547
HphI GGTGA 1 cut(s) 222
Hpy166II GTNNAC 1 cut(s) 430
Hpy188I TCNGA 3 cut(s) 190, 507, 528
Hpy188III TCNNGA 5 cut(s) 23, 69, 224, 541, 569
Hpy8I GTNNAC 1 cut(s) 430
HpyAV CCTTC 1 cut(s) 5
HpyCH4III ACNGT 2 cut(s) 409, 566
HpyCH4IV ACGT 1 cut(s) 35
HpyCH4V TGCA 6 cut(s) 60, 153, 264, 395, 447, 596
HpySE526I ACGT 1 cut(s) 35
Hsp92II CATG 3 cut(s) 157, 268, 572
Kzo9I GATC 3 cut(s) 160, 580, 598
LmnI GCTCC 2 cut(s) 25, 109
Lsp1109I GCAGC 3 cut(s) 379, 459, 580
LweI GCATC 1 cut(s) 225
MaeI CTAG 1 cut(s) 126
MaeII ACGT 1 cut(s) 35
MaeIII GTNAC 2 cut(s) 62, 87
MalI GATC 3 cut(s) 162, 582, 600
MboI GATC 3 cut(s) 160, 580, 598
MboII GAAGA 3 cut(s) 20, 41, 556
MflI RGATCY 1 cut(s) 598
MhlI GDGCHC 1 cut(s) 144
MluCI AATT 5 cut(s) 30, 182, 277, 283, 519
MlyI GAGTC 1 cut(s) 221
MmeI TCCRAC 1 cut(s) 300
MnlI CCTC 4 cut(s) 325, 365, 368, 382
MseI TTAA 1 cut(s) 281
MspA1I CMGCKG 1 cut(s) 450
NdeII GATC 3 cut(s) 160, 580, 598
NlaIII CATG 3 cut(s) 157, 268, 572
NlaIV GGNNCC 2 cut(s) 111, 324
NspI RCATGY 1 cut(s) 268
PagI TCATGA 1 cut(s) 568
PfeI GAWTC 2 cut(s) 535, 547
PflFI GACNNNGTC 1 cut(s) 127
PflMI CCANNNNNTGG 1 cut(s) 119
PkrI GCNGC 3 cut(s) 394, 449, 595
PleI GAGTC 1 cut(s) 221
PpsI GAGTC 1 cut(s) 221
PsiI TTATAA 1 cut(s) 607
PspFI CCCAGC 2 cut(s) 176, 335
PspN4I GGNNCC 2 cut(s) 111, 324
PspPI GGNCC 2 cut(s) 129, 499
PstI CTGCAG 1 cut(s) 598
PsuI RGATCY 1 cut(s) 598
PsyI GACNNNGTC 1 cut(s) 127
PvuII CAGCTG 1 cut(s) 450
SaqAI TTAA 1 cut(s) 281
SatI GCNGC 3 cut(s) 393, 448, 594
Sau3AI GATC 3 cut(s) 160, 580, 598
Sau96I GGNCC 2 cut(s) 129, 499
SchI GAGTC 1 cut(s) 221
SduI GDGCHC 1 cut(s) 144
SetI ASST 8 cut(s) 16, 38, 58, 131, 301, 328, 445, 452
SfaNI GCATC 1 cut(s) 225
SfcI CTRYAG 1 cut(s) 594
SinI GGWCC 2 cut(s) 129, 499
SmiI ATTTAAAT 1 cut(s) 282
SmlI CTYRAG 1 cut(s) 314
SmoI CTYRAG 1 cut(s) 314
Sse9I AATT 5 cut(s) 30, 182, 277, 283, 519
SspMI CTAG 1 cut(s) 126
SwaI ATTTAAAT 1 cut(s) 282
TaaI ACNGT 2 cut(s) 409, 566
TaiI ACGT 1 cut(s) 38
TaqI TCGA 2 cut(s) 159, 198
TasI AATT 5 cut(s) 30, 182, 277, 283, 519
TfiI GAWTC 2 cut(s) 535, 547
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TseI GCWGC 3 cut(s) 392, 447, 593
TspDTI ATGAA 5 cut(s) 17, 193, 428, 464, 531
TspGWI ACGGA 1 cut(s) 121
Tth111I GACNNNGTC 1 cut(s) 127
Van91I CCANNNNNTGG 1 cut(s) 119
VpaK11BI GGWCC 2 cut(s) 129, 499
XapI RAATTY 4 cut(s) 182, 277, 283, 519
XceI RCATGY 1 cut(s) 268
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.