Rmu_co8225350.1_g000001

Belongs to the glycosyltransferase 2 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8225350.1
Physical Location & Seq
Reverse (-)
2 .. 734
733 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8225350.1_g000001.1.cds

Sequence Viewer

Length: 178 bp
atgttcaaagataagcaatggaagccactaacgcgtgaagtgaaaatctcggctgcaattctcagtccgtatcggcttctagtactagctcgactggtggtccttggattatttttgtattggagagtcacaaaccctaatgatgatgcagtgtggttgtggcttatgtctgtgattt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.99

Weight (kDa)

9.99

Isoelectric Point (pI)

23.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 34
AfaI GTAC 1 cut(s) 84
AflIII ACRYGT 1 cut(s) 32
AgsI TTSAA 1 cut(s) 7
AhdI GACNNNNNGTC 1 cut(s) 98
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
ApeKI GCWGC 1 cut(s) 53
AspS9I GGNCC 1 cut(s) 100
AvaII GGWCC 1 cut(s) 100
BbvI GCAGC 1 cut(s) 40
BfaI CTAG 2 cut(s) 80, 86
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
BmcAI AGTACT 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 100
BmeRI GACNNNNNGTC 1 cut(s) 98
BmgT120I GGNCC 1 cut(s) 100
BmsI GCATC 1 cut(s) 136
BsaJI CCNNGG 1 cut(s) 103
Bse1I ACTGG 1 cut(s) 99
Bse3DI GCAATG 1 cut(s) 23
BseDI CCNNGG 1 cut(s) 103
BseMI GCAATG 1 cut(s) 23
BseMII CTCAG 1 cut(s) 76
BseNI ACTGG 1 cut(s) 99
BseXI GCAGC 1 cut(s) 40
Bsh1236I CGCG 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 75
BspFNI CGCG 1 cut(s) 34
BsrDI GCAATG 1 cut(s) 23
BsrI ACTGG 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 103
BssT1I CCWWGG 1 cut(s) 103
BstDEI CTNAG 1 cut(s) 62
BstFNI CGCG 1 cut(s) 34
BstMWI GCNNNNNNNGC 2 cut(s) 22, 31
BstUI CGCG 1 cut(s) 34
BstV1I GCAGC 1 cut(s) 40
BtsI GCAGTG 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 100
Csp6I GTAC 1 cut(s) 83
CviJI RGCY 5 cut(s) 25, 53, 76, 89, 163
CviKI_1 RGCY 5 cut(s) 25, 53, 76, 89, 163
CviQI GTAC 1 cut(s) 83
DdeI CTNAG 1 cut(s) 62
DriI GACNNNNNGTC 1 cut(s) 98
Eam1105I GACNNNNNGTC 1 cut(s) 98
Eco130I CCWWGG 1 cut(s) 103
Eco47I GGWCC 1 cut(s) 100
EcoT14I CCWWGG 1 cut(s) 103
ErhI CCWWGG 1 cut(s) 103
FaiI YATR 1 cut(s) 167
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 2 cut(s) 80, 86
GluI GCNGC 1 cut(s) 54
HinfI GANTC 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 56, 149
HpyF10VI GCNNNNNNNGC 2 cut(s) 22, 31
HpyF3I CTNAG 1 cut(s) 62
LpnPI CCDG 1 cut(s) 80
Lsp1109I GCAGC 1 cut(s) 40
LweI GCATC 1 cut(s) 136
MaeI CTAG 2 cut(s) 80, 86
MaeIII GTNAC 1 cut(s) 127
MluCI AATT 1 cut(s) 57
MluI ACGCGT 1 cut(s) 32
MlyI GAGTC 1 cut(s) 135
MvnI CGCG 1 cut(s) 34
MwoI GCNNNNNNNGC 2 cut(s) 22, 31
NmeAIII GCCGAG 1 cut(s) 29
NmuCI GTSAC 1 cut(s) 127
PkrI GCNGC 1 cut(s) 55
PleI GAGTC 1 cut(s) 134
PpsI GAGTC 1 cut(s) 134
PspPI GGNCC 1 cut(s) 100
RsaI GTAC 1 cut(s) 84
RsaNI GTAC 1 cut(s) 83
SatI GCNGC 1 cut(s) 54
Sau96I GGNCC 1 cut(s) 100
ScaI AGTACT 1 cut(s) 84
SchI GAGTC 1 cut(s) 135
SetI ASST 1 cut(s) 91
SfaNI GCATC 1 cut(s) 136
SgeI CNNG 8 cut(s) 45, 47, 61, 92, 98, 102, 107, 116
SinI GGWCC 1 cut(s) 100
Sse9I AATT 1 cut(s) 57
SspMI CTAG 2 cut(s) 80, 86
StyI CCWWGG 1 cut(s) 103
TaqI TCGA 1 cut(s) 91
TasI AATT 1 cut(s) 57
TatI WGTACW 1 cut(s) 82
TscAI CASTG 1 cut(s) 156
TseFI GTSAC 1 cut(s) 127
TseI GCWGC 1 cut(s) 53
Tsp45I GTSAC 1 cut(s) 127
TspGWI ACGGA 1 cut(s) 57
TspRI CASTG 1 cut(s) 156
VpaK11BI GGWCC 1 cut(s) 100
XspI CTAG 2 cut(s) 80, 86
ZrmI AGTACT 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.