Rmu_co8261001.1_g000001

Plant intracellular Ras-group-related LRR protein 7-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8261001.1
Physical Location & Seq
Reverse (-)
2 .. 774
773 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8261001.1_g000001.1.cds

Sequence Viewer

Length: 300 bp
atgatttcggttgcttcagataattcaattgaagatcttcccgaatccgtctgcaatcttgttcacttaaagtcactttgcttggacaataataatgtgaagcagatacctaccaatctattgaaagactgtaaagctctgcagaatatttccttgcatggaaatcctatatcaatggatcagtttcagcaaatggaaggattccaagagtttgaagcaaggaggaagaagaagttcgacaaacagattgactcaaatgtaatgatcagttccaaaggccttgatgagggtgttgatcat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.28

Weight (kDa)

5.22

Isoelectric Point (pI)

40.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 186
AfiI CCNNNNNNNGG 1 cut(s) 286
AgsI TTSAA 4 cut(s) 27, 32, 124, 215
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AlwI GGATC 1 cut(s) 186
AoxI GGCC 1 cut(s) 277
Asp700I GAANNNNTTC 2 cut(s) 36, 233
BclI TGATCA 2 cut(s) 264, 295
BfmI CTRYAG 1 cut(s) 140
BglII AGATCT 1 cut(s) 34
Bsc4I CCNNNNNNNGG 1 cut(s) 286
BseLI CCNNNNNNNGG 1 cut(s) 286
BshFI GGCC 1 cut(s) 279
BslI CCNNNNNNNGG 1 cut(s) 286
BsnI GGCC 1 cut(s) 279
Bsp143I GATC 4 cut(s) 34, 178, 264, 295
BspANI GGCC 1 cut(s) 279
BspMAI CTGCAG 1 cut(s) 144
BspPI GGATC 1 cut(s) 186
BssMI GATC 4 cut(s) 34, 178, 264, 295
Bst4CI ACNGT 1 cut(s) 131
BstENI CCTNNNNNAGG 1 cut(s) 284
BstKTI GATC 4 cut(s) 37, 181, 267, 298
BstMBI GATC 4 cut(s) 34, 178, 264, 295
BstSFI CTRYAG 1 cut(s) 140
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
BsuRI GGCC 1 cut(s) 279
CviAII CATG 1 cut(s) 158
CviJI RGCY 2 cut(s) 137, 279
CviKI_1 RGCY 2 cut(s) 137, 279
DpnI GATC 4 cut(s) 36, 180, 266, 297
DpnII GATC 4 cut(s) 34, 178, 264, 295
Eco147I AGGCCT 1 cut(s) 279
EcoNI CCTNNNNNAGG 1 cut(s) 284
FaeI CATG 1 cut(s) 161
FaiI YATR 2 cut(s) 159, 170
FatI CATG 1 cut(s) 157
FbaI TGATCA 2 cut(s) 264, 295
HaeIII GGCC 1 cut(s) 279
Hin1II CATG 1 cut(s) 161
HinfI GANTC 3 cut(s) 44, 201, 251
Hpy166II GTNNAC 1 cut(s) 64
Hpy188I TCNGA 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 41
Hpy8I GTNNAC 1 cut(s) 64
HpyAV CCTTC 1 cut(s) 191
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 3 cut(s) 54, 142, 157
Hsp92II CATG 1 cut(s) 161
Ksp22I TGATCA 2 cut(s) 264, 295
Kzo9I GATC 4 cut(s) 34, 178, 264, 295
MaeIII GTNAC 1 cut(s) 72
MalI GATC 4 cut(s) 36, 180, 266, 297
MboI GATC 4 cut(s) 34, 178, 264, 295
MboII GAAGA 4 cut(s) 29, 44, 238, 241
MfeI CAATTG 1 cut(s) 27
MflI RGATCY 1 cut(s) 34
MluCI AATT 2 cut(s) 22, 27
MlyI GAGTC 1 cut(s) 245
MnlI CCTC 2 cut(s) 216, 280
MroXI GAANNNNTTC 2 cut(s) 36, 233
MseI TTAA 1 cut(s) 68
MunI CAATTG 1 cut(s) 27
NdeII GATC 4 cut(s) 34, 178, 264, 295
NlaIII CATG 1 cut(s) 161
NmuCI GTSAC 1 cut(s) 72
PceI AGGCCT 1 cut(s) 279
PdmI GAANNNNTTC 2 cut(s) 36, 233
PfeI GAWTC 2 cut(s) 44, 201
PleI GAGTC 1 cut(s) 245
PpsI GAGTC 1 cut(s) 245
PstI CTGCAG 1 cut(s) 144
PsuI RGATCY 1 cut(s) 34
SaqAI TTAA 1 cut(s) 68
Sau3AI GATC 4 cut(s) 34, 178, 264, 295
SchI GAGTC 1 cut(s) 245
SetI ASST 2 cut(s) 112, 139
SfcI CTRYAG 1 cut(s) 140
SgeI CNNG 8 cut(s) 53, 71, 94, 166, 170, 218, 231, 293
Sse9I AATT 2 cut(s) 22, 27
SseBI AGGCCT 1 cut(s) 279
SspI AATATT 1 cut(s) 148
StuI AGGCCT 1 cut(s) 279
TaaI ACNGT 1 cut(s) 131
TaqI TCGA 1 cut(s) 237
TasI AATT 2 cut(s) 22, 27
TfiI GAWTC 2 cut(s) 44, 201
Tru1I TTAA 1 cut(s) 68
Tru9I TTAA 1 cut(s) 68
TseFI GTSAC 1 cut(s) 72
Tsp45I GTSAC 1 cut(s) 72
TspGWI ACGGA 1 cut(s) 37
XagI CCTNNNNNAGG 1 cut(s) 284
XmnI GAANNNNTTC 2 cut(s) 36, 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.