Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8299773.1

Orthogroup ID

OG0010766

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 853

Gene Structure 853 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8299773.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 609 bp

gaccaggtgaagccggcgctgcggagaaagcacgccggcgaaatgagggaagccaagcgagggattcgaaggttccagaagctgatgcacggcgtttcgaatttccaaacggcgctgaagacggtcatcagcggaactcctcggttccgaacagcgcttctgattctcggagggaatccaatgcgacctcaacacgtgtacgaattgagcttctccggaaatgtcagtggcgaagaattggattttgcgaaaagcagagcggcggaagtgctttgtagaaaagcgattcgggggttggtctcggagaatgttgggtctgtttcgtatccgggtccttggaagctgttcctgttggttaaagctccctcttctttccatcagcctctgcattttcttcccaagcgagattttaaatacagcaacaagattgtgcctatgaggctaagcttcaaatgcaaaaaccagaaccagaacattgatcagttttcgcaaaccggcagctctgatgggttggttcagtctgctccggatggtgatgattttatatggtttcaatgtcgacatgtaatcaagggaatagcatttaacacagtacctgaaggagaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

p31comet

Protein Analysis

202

Amino Acids

22.73

Weight (kDa)

10.01

Isoelectric Point (pI)

29.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010766)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G03180 AT1G03180 AT1G03180 AT1G03180 AT1G03180 AT1G03180
fragaria_vesca	FvH4_2g23671 FvH4_2g23671 FvH4_2g23671 FvH4_2g23671
malus_domestica	MD11G1286600.v1.1
prunus_persica	Prupe.8G241900_v2.0.a1
pyrus_communis	pycom11g25410
rosa_chinensis	RchiOBHm_Chr6g0291141
rosa_multiflora	Rmu_co8299773.1_g000001
rosa_samantha	Rh6AG328300 Rh6BG335900 Rh6CG341900 Rh6DG329200
rosa_wichuraiana	Rw6G028560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	260
AccI	GTMKAC	1 cut(s)	559
AccIII	TCCGGA	2 cut(s)	215, 526
AciI	CCGC	4 cut(s)	22, 132, 260, 263
AcsI	RAATTY	1 cut(s)	100
AcuI	CTGAAG	1 cut(s)	137
AcvI	CACGTG	1 cut(s)	196
AfaI	GTAC	2 cut(s)	200, 594
AfeI	AGCGCT	1 cut(s)	156
AfiI	CCNNNNNNNGG	1 cut(s)	60
AflIII	ACRYGT	3 cut(s)	193, 195, 562
AgsI	TTSAA	2 cut(s)	451, 554
AjnI	CCWGG	1 cut(s)	3
AluBI	AGCT	6 cut(s)	82, 210, 343, 362, 447, 501
AluI	AGCT	6 cut(s)	82, 210, 343, 362, 447, 501
Alw26I	GTCTC	1 cut(s)	304
AlwNI	CAGNNNCTG	3 cut(s)	82, 385, 596
Aor13HI	TCCGGA	2 cut(s)	215, 526
Aor51HI	AGCGCT	1 cut(s)	156
ApeKI	GCWGC	2 cut(s)	19, 498
ApoI	RAATTY	1 cut(s)	100
Asp700I	GAANNNNTTC	1 cut(s)	344
AspLEI	GCGC	3 cut(s)	19, 115, 157
AspS9I	GGNCC	1 cut(s)	332
AsuC2I	CCSGG	1 cut(s)	330
AsuHPI	GGTGA	2 cut(s)	19, 545
AsuII	TTCGAA	2 cut(s)	67, 98
AvaII	GGWCC	1 cut(s)	332
BbrPI	CACGTG	1 cut(s)	196
BbsI	GAAGAC	1 cut(s)	125
BbvI	GCAGC	2 cut(s)	6, 510
BccI	CCATC	3 cut(s)	384, 500, 524
BceAI	ACGGC	2 cut(s)	106, 126
BciT130I	CCWGG	1 cut(s)	5
BciVI	GTATCC	1 cut(s)	336
BclI	TGATCA	1 cut(s)	478
BcnI	CCSGG	1 cut(s)	330
BcoDI	GTCTC	1 cut(s)	304
BfoI	RGCGCY	3 cut(s)	20, 116, 158
BfuI	GTATCC	1 cut(s)	336
BglI	GCCNNNNNGGC	1 cut(s)	439
BisI	GCNGC	3 cut(s)	20, 261, 499
BlpI	GCTNAGC	1 cut(s)	443
BlsI	GCNGC	3 cut(s)	21, 262, 500
Bme1390I	CCNGG	2 cut(s)	5, 330
Bme18I	GGWCC	1 cut(s)	332
BmgT120I	GGNCC	1 cut(s)	332
BmiI	GGNNCC	3 cut(s)	74, 146, 333
BmrFI	CCNGG	2 cut(s)	5, 330
BmsI	GCATC	1 cut(s)	75
BpiI	GAAGAC	1 cut(s)	125
Bpu1102I	GCTNAGC	1 cut(s)	443
Bpu14I	TTCGAA	2 cut(s)	67, 98
BpuMI	CCSGG	1 cut(s)	330
BsaAI	YACGTR	1 cut(s)	196
BsaI	GGTCTC	1 cut(s)	304
BsaJI	CCNNGG	2 cut(s)	140, 335
BsaWI	WCCGGW	2 cut(s)	215, 526
Bsc4I	CCNNNNNNNGG	1 cut(s)	60
Bse118I	RCCGGY	3 cut(s)	13, 35, 494
BseAI	TCCGGA	2 cut(s)	215, 526
BseBI	CCWGG	1 cut(s)	5
BseDI	CCNNGG	2 cut(s)	140, 335
BseGI	GGATG	1 cut(s)	535
BseLI	CCNNNNNNNGG	1 cut(s)	60
BseRI	GAGGAG	1 cut(s)	129
BseXI	GCAGC	2 cut(s)	6, 510
BsiSI	CCGG	6 cut(s)	14, 36, 216, 329, 495, 527
BslI	CCNNNNNNNGG	1 cut(s)	60
BsmAI	GTCTC	1 cut(s)	304
Bso31I	GGTCTC	1 cut(s)	304
Bsp119I	TTCGAA	2 cut(s)	67, 98
Bsp13I	TCCGGA	2 cut(s)	215, 526
Bsp143I	GATC	1 cut(s)	478
Bsp1720I	GCTNAGC	1 cut(s)	443
BspACI	CCGC	4 cut(s)	22, 132, 260, 263
BspEI	TCCGGA	2 cut(s)	215, 526
BspLI	GGNNCC	3 cut(s)	74, 146, 333
BspT104I	TTCGAA	2 cut(s)	67, 98
BspTNI	GGTCTC	1 cut(s)	304
BsrBI	CCGCTC	1 cut(s)	260
BsrFI	RCCGGY	3 cut(s)	13, 35, 494
BssAI	RCCGGY	3 cut(s)	13, 35, 494
BssECI	CCNNGG	2 cut(s)	140, 335
BssMI	GATC	1 cut(s)	478
BssT1I	CCWWGG	1 cut(s)	335
Bst2UI	CCWGG	1 cut(s)	5
Bst4CI	ACNGT	2 cut(s)	124, 592
Bst6I	CTCTTC	1 cut(s)	373
BstBAI	YACGTR	1 cut(s)	196
BstBI	TTCGAA	2 cut(s)	67, 98
BstC8I	GCNNGC	3 cut(s)	15, 33, 37
BstDEI	CTNAG	1 cut(s)	443
BstF5I	GGATG	1 cut(s)	535
BstH2I	RGCGCY	3 cut(s)	20, 116, 158
BstHHI	GCGC	3 cut(s)	19, 115, 157
BstKTI	GATC	1 cut(s)	481
BstMAI	GTCTC	1 cut(s)	304
BstMBI	GATC	1 cut(s)	478
BstMWI	GCNNNNNNNGC	4 cut(s)	19, 28, 439, 453
BstNI	CCWGG	1 cut(s)	5
BstNSI	RCATGY	1 cut(s)	566
BstSCI	CCNGG	2 cut(s)	3, 328
BstV1I	GCAGC	2 cut(s)	6, 510
BstV2I	GAAGAC	1 cut(s)	125
BsuI	GTATCC	1 cut(s)	336
BtsCI	GGATG	1 cut(s)	535
BtsIMutI	CAGTG	1 cut(s)	232
Cac8I	GCNNGC	3 cut(s)	15, 33, 37
CaiI	CAGNNNCTG	3 cut(s)	82, 385, 596
CfoI	GCGC	3 cut(s)	19, 115, 157
Cfr10I	RCCGGY	3 cut(s)	13, 35, 494
Cfr13I	GGNCC	1 cut(s)	332
CsiI	ACCWGGT	1 cut(s)	3
Csp6I	GTAC	2 cut(s)	199, 593
CviAII	CATG	1 cut(s)	563
CviQI	GTAC	2 cut(s)	199, 593
DdeI	CTNAG	1 cut(s)	443
DpnI	GATC	1 cut(s)	480
DpnII	GATC	1 cut(s)	478
DraI	TTTAAA	1 cut(s)	412
Eam1104I	CTCTTC	1 cut(s)	373
EarI	CTCTTC	1 cut(s)	373
EciI	GGCGGA	1 cut(s)	278
Eco130I	CCWWGG	1 cut(s)	335
Eco31I	GGTCTC	1 cut(s)	304
Eco47I	GGWCC	1 cut(s)	332
Eco47III	AGCGCT	1 cut(s)	156
Eco57I	CTGAAG	1 cut(s)	137
Eco72I	CACGTG	1 cut(s)	196
EcoO109I	RGGNCCY	1 cut(s)	332
EcoRII	CCWGG	1 cut(s)	3
EcoT14I	CCWWGG	1 cut(s)	335
ErhI	CCWWGG	1 cut(s)	335
FaeI	CATG	1 cut(s)	566
FaiI	YATR	4 cut(s)	437, 545, 547, 564
FatI	CATG	1 cut(s)	562
FbaI	TGATCA	1 cut(s)	478
FblI	GTMKAC	1 cut(s)	559
Fnu4HI	GCNGC	3 cut(s)	20, 261, 499
FokI	GGATG	1 cut(s)	542
Fsp4HI	GCNGC	3 cut(s)	20, 261, 499
GlaI	GCGC	3 cut(s)	18, 114, 156
GluI	GCNGC	3 cut(s)	20, 261, 499
HaeII	RGCGCY	3 cut(s)	20, 116, 158
HapII	CCGG	6 cut(s)	14, 36, 216, 329, 495, 527
HhaI	GCGC	3 cut(s)	19, 115, 157
Hin1II	CATG	1 cut(s)	566
Hin6I	GCGC	3 cut(s)	17, 113, 155
HinP1I	GCGC	3 cut(s)	17, 113, 155
HincII	GTYRAC	1 cut(s)	560
HindII	GTYRAC	1 cut(s)	560
HindIII	AAGCTT	1 cut(s)	445
HinfI	GANTC	4 cut(s)	64, 163, 175, 286
HpaII	CCGG	6 cut(s)	14, 36, 216, 329, 495, 527
HphI	GGTGA	2 cut(s)	19, 545
Hpy166II	GTNNAC	2 cut(s)	199, 560
Hpy188I	TCNGA	5 cut(s)	149, 162, 170, 304, 505
Hpy188III	TCNNGA	3 cut(s)	76, 216, 527
Hpy8I	GTNNAC	2 cut(s)	199, 560
HpyAV	CCTTC	2 cut(s)	63, 593
HpyCH4III	ACNGT	2 cut(s)	124, 592
HpyCH4IV	ACGT	1 cut(s)	195
HpyCH4V	TGCA	3 cut(s)	88, 388, 456
HpyF10VI	GCNNNNNNNGC	4 cut(s)	19, 28, 439, 453
HpyF3I	CTNAG	1 cut(s)	443
HpySE526I	ACGT	1 cut(s)	195
Hsp92II	CATG	1 cut(s)	566
HspAI	GCGC	3 cut(s)	17, 113, 155
Kpn2I	TCCGGA	2 cut(s)	215, 526
KroI	GCCGGC	2 cut(s)	13, 35
KroNI	GCCGGC	2 cut(s)	15, 37
Ksp22I	TGATCA	1 cut(s)	478
Kzo9I	GATC	1 cut(s)	478
LmnI	GCTCC	2 cut(s)	367, 529
Lsp1109I	GCAGC	2 cut(s)	6, 510
LweI	GCATC	1 cut(s)	75
MabI	ACCWGGT	1 cut(s)	3
MaeII	ACGT	1 cut(s)	195
MalI	GATC	1 cut(s)	480
MbiI	CCGCTC	1 cut(s)	260
MboI	GATC	1 cut(s)	478
MboII	GAAGA	4 cut(s)	130, 245, 360, 386
MluCI	AATT	3 cut(s)	100, 203, 236
MnlI	CCTC	8 cut(s)	39, 53, 150, 164, 198, 376, 393, 432
MreI	CGCCGGCG	1 cut(s)	35
MroI	TCCGGA	2 cut(s)	215, 526
MroNI	GCCGGC	2 cut(s)	13, 35
MroXI	GAANNNNTTC	1 cut(s)	344
MseI	TTAA	3 cut(s)	357, 411, 585
MspA1I	CMGCKG	1 cut(s)	132
MspI	CCGG	6 cut(s)	14, 36, 216, 329, 495, 527
MspR9I	CCNGG	2 cut(s)	5, 330
MvaI	CCWGG	1 cut(s)	5
MwoI	GCNNNNNNNGC	4 cut(s)	19, 28, 439, 453
NaeI	GCCGGC	2 cut(s)	15, 37
NciI	CCSGG	1 cut(s)	330
NdeII	GATC	1 cut(s)	478
NgoMIV	GCCGGC	2 cut(s)	13, 35
NlaIII	CATG	1 cut(s)	566
NlaIV	GGNNCC	3 cut(s)	74, 146, 333
NspI	RCATGY	1 cut(s)	566
NspV	TTCGAA	2 cut(s)	67, 98
PciI	ACATGT	1 cut(s)	562
PdiI	GCCGGC	2 cut(s)	15, 37
PdmI	GAANNNNTTC	1 cut(s)	344
PfeI	GAWTC	4 cut(s)	64, 163, 175, 286
PkrI	GCNGC	3 cut(s)	21, 262, 500
PmaCI	CACGTG	1 cut(s)	196
PmlI	CACGTG	1 cut(s)	196
Ppu21I	YACGTR	1 cut(s)	196
PpuMI	RGGWCCY	1 cut(s)	332
PscI	ACATGT	1 cut(s)	562
Psp5II	RGGWCCY	1 cut(s)	332
Psp6I	CCWGG	1 cut(s)	3
PspCI	CACGTG	1 cut(s)	196
PspGI	CCWGG	1 cut(s)	3
PspN4I	GGNNCC	3 cut(s)	74, 146, 333
PspPI	GGNCC	1 cut(s)	332
PspPPI	RGGWCCY	1 cut(s)	332
PstNI	CAGNNNCTG	3 cut(s)	82, 385, 596
RsaI	GTAC	2 cut(s)	200, 594
RsaNI	GTAC	2 cut(s)	199, 593
SalI	GTCGAC	1 cut(s)	558
SaqAI	TTAA	3 cut(s)	357, 411, 585
SatI	GCNGC	3 cut(s)	20, 261, 499
Sau3AI	GATC	1 cut(s)	478
Sau96I	GGNCC	1 cut(s)	332
ScrFI	CCNGG	2 cut(s)	5, 330
SexAI	ACCWGGT	1 cut(s)	3
SfaNI	GCATC	1 cut(s)	75
SfuI	TTCGAA	2 cut(s)	67, 98
SgrAI	CRCCGGYG	1 cut(s)	35
SinI	GGWCC	1 cut(s)	332
Sse9I	AATT	3 cut(s)	100, 203, 236
SsiI	CCGC	4 cut(s)	22, 132, 260, 263
StyD4I	CCNGG	2 cut(s)	3, 328
StyI	CCWWGG	1 cut(s)	335
TaaI	ACNGT	2 cut(s)	124, 592
TaiI	ACGT	1 cut(s)	198
TaqI	TCGA	3 cut(s)	67, 98, 559
TasI	AATT	3 cut(s)	100, 203, 236
TauI	GCSGC	1 cut(s)	263
TfiI	GAWTC	4 cut(s)	64, 163, 175, 286
Tru1I	TTAA	3 cut(s)	357, 411, 585
Tru9I	TTAA	3 cut(s)	357, 411, 585
TscAI	CASTG	1 cut(s)	232
TseI	GCWGC	2 cut(s)	19, 498
TspRI	CASTG	1 cut(s)	232
VpaK11BI	GGWCC	1 cut(s)	332
XapI	RAATTY	1 cut(s)	100
XceI	RCATGY	1 cut(s)	566
XmiI	GTMKAC	1 cut(s)	559
XmnI	GAANNNNTTC	1 cut(s)	344

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.