Rmu_co8317187.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8317187.1
Physical Location & Seq
Reverse (-)
2 .. 707
706 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8317187.1_g000001.1.cds

Sequence Viewer

Length: 706 bp
atgtcacgcgccggtgttttacccgactgctacaccatccccattgttttgaaaacactgtgtcagctttttgctgtggggatcggcaggcagcttcattctgtggctgtgaggattgggctcgactcaaatgagttctgtgagagtgggtttattaacttgtattccaaggcgggagagtttgagaatgcacggaacgtgttcgatcaaaaccctgagagaaagctgggctcttggaatgccctcattgcggggctttcgcaaggcgggcgtgctagggaagctgtagagatgtttatagagcttaggaaatgcgggttactgccggatgatgtgaccatggttagtgtcacgtcagcttgtggtggtctgggtgacttggggttggctcttcagttgcataagtgtgtttatcaagctgaaatcgttgcggagaaatcggatgtgctgatgttgaattcgcttgttgatatgtatgggaaatgtgggaggatggacttggctcacagggtgttttcgaggatggagcaacagaatgtgtcgtcgtggacgtcgatgattgtggggtatgggatgcacgggcatgtggatgaggcgctggaatgctttcggtgcatgagggaggcgggagtgaggccgaaccatgtgacctttgttggggtgctcagtgcatgtgttcatggggggacagtccaagagggaagat

Protein Analysis

235

Amino Acids

25.68

Weight (kDa)

6.16

Isoelectric Point (pI)

30.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015111)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 554
AccII CGCG 1 cut(s) 9
AciI CCGC 6 cut(s) 173, 251, 267, 315, 431, 626
AclWI GGATC 1 cut(s) 89
AcsI RAATTY 1 cut(s) 457
AcuI CTGAAG 1 cut(s) 377
AcyI GRCGYC 1 cut(s) 551
AdeI CACNNNGTG 1 cut(s) 511
AfiI CCNNNNNNNGG 2 cut(s) 250, 657
AflIII ACRYGT 1 cut(s) 198
AgsI TTSAA 2 cut(s) 52, 457
AjiI CACGTC 1 cut(s) 354
AluBI AGCT 7 cut(s) 67, 94, 226, 284, 304, 359, 419
AluI AGCT 7 cut(s) 67, 94, 226, 284, 304, 359, 419
Alw21I GWGCWC 1 cut(s) 666
AlwI GGATC 1 cut(s) 89
AoxI GGCC 1 cut(s) 635
ApeKI GCWGC 1 cut(s) 91
ApoI RAATTY 1 cut(s) 457
Asp700I GAANNNNTTC 2 cut(s) 200, 606
AspLEI GCGC 2 cut(s) 11, 598
AsuHPI GGTGA 1 cut(s) 386
BanII GRGCYC 2 cut(s) 123, 233
Bbv12I GWGCWC 1 cut(s) 666
BbvI GCAGC 1 cut(s) 103
BccI CCATC 3 cut(s) 44, 487, 517
BfaI CTAG 1 cut(s) 276
BfmI CTRYAG 1 cut(s) 285
BfoI RGCGCY 1 cut(s) 599
BisI GCNGC 1 cut(s) 92
BlsI GCNGC 1 cut(s) 93
BmgBI CACGTC 1 cut(s) 354
BmsI GCATC 1 cut(s) 564
Bpu10I CCTNAGC 1 cut(s) 305
BsaHI GRCGYC 1 cut(s) 551
BsaJI CCNNGG 2 cut(s) 168, 339
Bsc4I CCNNNNNNNGG 2 cut(s) 250, 657
Bse118I RCCGGY 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 246
BseDI CCNNGG 2 cut(s) 168, 339
BseGI GGATG 7 cut(s) 36, 334, 448, 498, 528, 579, 595
BseLI CCNNNNNNNGG 2 cut(s) 250, 657
BseMI GCAATG 1 cut(s) 246
BseMII CTCAG 2 cut(s) 207, 679
BseXI GCAGC 1 cut(s) 103
BseYI CCCAGC 1 cut(s) 226
Bsh1236I CGCG 1 cut(s) 9
BshFI GGCC 1 cut(s) 637
BsiHKAI GWGCWC 1 cut(s) 666
BsiSI CCGG 2 cut(s) 12, 326
BslFI GGGAC 1 cut(s) 700
BslI CCNNNNNNNGG 2 cut(s) 250, 657
BsmFI GGGAC 1 cut(s) 700
BsmI GAATGC 3 cut(s) 193, 244, 608
BsnI GGCC 1 cut(s) 637
Bsp1286I GDGCHC 3 cut(s) 123, 233, 666
Bsp143I GATC 2 cut(s) 81, 205
Bsp19I CCATGG 1 cut(s) 339
BspACI CCGC 6 cut(s) 173, 251, 267, 315, 431, 626
BspANI GGCC 1 cut(s) 637
BspCNI CTCAG 2 cut(s) 208, 678
BspFNI CGCG 1 cut(s) 9
BspPI GGATC 1 cut(s) 89
BspQI GCTCTTC 1 cut(s) 396
BsrDI GCAATG 1 cut(s) 246
BsrFI RCCGGY 1 cut(s) 11
BssAI RCCGGY 1 cut(s) 11
BssECI CCNNGG 2 cut(s) 168, 339
BssMI GATC 2 cut(s) 81, 205
BssNI GRCGYC 1 cut(s) 551
BssT1I CCWWGG 2 cut(s) 168, 339
Bst4CI ACNGT 2 cut(s) 60, 691
Bst6I CTCTTC 1 cut(s) 396
BstACI GRCGYC 1 cut(s) 551
BstC8I GCNNGC 3 cut(s) 89, 269, 273
BstDEI CTNAG 3 cut(s) 216, 305, 665
BstDSI CCRYGG 1 cut(s) 339
BstF5I GGATG 7 cut(s) 36, 334, 448, 498, 528, 579, 595
BstFNI CGCG 1 cut(s) 9
BstH2I RGCGCY 1 cut(s) 599
BstHHI GCGC 2 cut(s) 11, 598
BstKTI GATC 2 cut(s) 84, 208
BstMBI GATC 2 cut(s) 81, 205
BstMWI GCNNNNNNNGC 4 cut(s) 248, 268, 281, 612
BstNSI RCATGY 2 cut(s) 587, 675
BstSFI CTRYAG 1 cut(s) 285
BstUI CGCG 1 cut(s) 9
BstV1I GCAGC 1 cut(s) 103
BsuRI GGCC 1 cut(s) 637
BtgI CCRYGG 1 cut(s) 339
BtrI CACGTC 1 cut(s) 354
BtsCI GGATG 7 cut(s) 36, 334, 448, 498, 528, 579, 595
BtsIMutI CAGTG 2 cut(s) 56, 673
Cac8I GCNNGC 3 cut(s) 89, 269, 273
CfoI GCGC 2 cut(s) 11, 598
Cfr10I RCCGGY 1 cut(s) 11
CviAII CATG 6 cut(s) 340, 584, 616, 644, 672, 680
DdeI CTNAG 3 cut(s) 216, 305, 665
DpnI GATC 2 cut(s) 83, 207
DpnII GATC 2 cut(s) 81, 205
DraIII CACNNNGTG 1 cut(s) 511
Eam1104I CTCTTC 1 cut(s) 396
EarI CTCTTC 1 cut(s) 396
Eco130I CCWWGG 2 cut(s) 168, 339
Eco24I GRGCYC 2 cut(s) 123, 233
Eco57I CTGAAG 1 cut(s) 377
EcoRI GAATTC 1 cut(s) 457
EcoT14I CCWWGG 2 cut(s) 168, 339
EcoT38I GRGCYC 2 cut(s) 123, 233
ErhI CCWWGG 2 cut(s) 168, 339
FaeI CATG 6 cut(s) 343, 587, 619, 647, 675, 683
FaqI GGGAC 1 cut(s) 700
FatI CATG 6 cut(s) 339, 583, 615, 643, 671, 679
FauI CCCGC 5 cut(s) 166, 244, 260, 308, 619
Fnu4HI GCNGC 1 cut(s) 92
FokI GGATG 7 cut(s) 23, 341, 455, 505, 535, 586, 602
FriOI GRGCYC 2 cut(s) 123, 233
Fsp4HI GCNGC 1 cut(s) 92
FspBI CTAG 1 cut(s) 276
GlaI GCGC 2 cut(s) 10, 597
GluI GCNGC 1 cut(s) 92
GsaI CCCAGC 1 cut(s) 230
HaeII RGCGCY 1 cut(s) 599
HaeIII GGCC 1 cut(s) 637
HapII CCGG 2 cut(s) 12, 326
HhaI GCGC 2 cut(s) 11, 598
Hin1I GRCGYC 1 cut(s) 551
Hin1II CATG 6 cut(s) 343, 587, 619, 647, 675, 683
Hin6I GCGC 2 cut(s) 9, 596
HinP1I GCGC 2 cut(s) 9, 596
HinfI GANTC 1 cut(s) 125
HpaII CCGG 2 cut(s) 12, 326
HphI GGTGA 1 cut(s) 386
Hpy166II GTNNAC 1 cut(s) 549
Hpy188I TCNGA 1 cut(s) 442
Hpy8I GTNNAC 1 cut(s) 549
Hpy99I CGWCG 2 cut(s) 547, 556
HpyCH4III ACNGT 2 cut(s) 60, 691
HpyCH4IV ACGT 3 cut(s) 198, 353, 551
HpyCH4V TGCA 5 cut(s) 191, 400, 577, 615, 671
HpyF10VI GCNNNNNNNGC 4 cut(s) 248, 268, 281, 612
HpyF3I CTNAG 3 cut(s) 216, 305, 665
HpySE526I ACGT 3 cut(s) 198, 353, 551
Hsp92I GRCGYC 1 cut(s) 551
Hsp92II CATG 6 cut(s) 343, 587, 619, 647, 675, 683
HspAI GCGC 2 cut(s) 9, 596
Kzo9I GATC 2 cut(s) 81, 205
LguI GCTCTTC 1 cut(s) 396
LmnI GCTCC 1 cut(s) 526
LpnPI CCDG 8 cut(s) 25, 73, 212, 228, 339, 356, 493, 584
Lsp1109I GCAGC 1 cut(s) 103
LweI GCATC 1 cut(s) 564
MaeI CTAG 1 cut(s) 276
MaeII ACGT 3 cut(s) 198, 353, 551
MaeIII GTNAC 6 cut(s) 3, 318, 334, 349, 374, 646
MalI GATC 2 cut(s) 83, 207
MboI GATC 2 cut(s) 81, 205
MboII GAAGA 1 cut(s) 383
MhlI GDGCHC 3 cut(s) 123, 233, 666
MluCI AATT 1 cut(s) 457
MlyI GAGTC 1 cut(s) 119
MnlI CCTC 9 cut(s) 105, 254, 483, 513, 586, 612, 616, 627, 691
MroXI GAANNNNTTC 2 cut(s) 200, 606
MseI TTAA 1 cut(s) 156
MslI CAYNNNNRTG 3 cut(s) 405, 582, 588
MspI CCGG 2 cut(s) 12, 326
Mva1269I GAATGC 3 cut(s) 193, 244, 608
MvnI CGCG 1 cut(s) 9
MwoI GCNNNNNNNGC 4 cut(s) 248, 268, 281, 612
NcoI CCATGG 1 cut(s) 339
NdeII GATC 2 cut(s) 81, 205
NlaIII CATG 6 cut(s) 343, 587, 619, 647, 675, 683
NmuCI GTSAC 5 cut(s) 3, 334, 349, 374, 646
NspI RCATGY 2 cut(s) 587, 675
PciSI GCTCTTC 1 cut(s) 396
PcsI WCGNNNNNNNCGW 2 cut(s) 548, 551
PctI GAATGC 3 cut(s) 193, 244, 608
PdmI GAANNNNTTC 2 cut(s) 200, 606
PkrI GCNGC 1 cut(s) 93
PleI GAGTC 1 cut(s) 119
PpsI GAGTC 1 cut(s) 119
PspFI CCCAGC 1 cut(s) 226
RseI CAYNNNNRTG 3 cut(s) 405, 582, 588
SapI GCTCTTC 1 cut(s) 396
SaqAI TTAA 1 cut(s) 156
SatI GCNGC 1 cut(s) 92
Sau3AI GATC 2 cut(s) 81, 205
SchI GAGTC 1 cut(s) 119
SduI GDGCHC 3 cut(s) 123, 233, 666
SfaNI GCATC 1 cut(s) 564
SfcI CTRYAG 1 cut(s) 285
SgrAI CRCCGGYG 1 cut(s) 11
SmiMI CAYNNNNRTG 3 cut(s) 405, 582, 588
Sse9I AATT 1 cut(s) 457
SsiI CCGC 6 cut(s) 173, 251, 267, 315, 431, 626
SspMI CTAG 1 cut(s) 276
StyI CCWWGG 2 cut(s) 168, 339
TaaI ACNGT 2 cut(s) 60, 691
TaiI ACGT 3 cut(s) 201, 356, 554
TaqI TCGA 4 cut(s) 123, 204, 518, 554
TasI AATT 1 cut(s) 457
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TscAI CASTG 2 cut(s) 63, 673
TseFI GTSAC 5 cut(s) 3, 334, 349, 374, 646
TseI GCWGC 1 cut(s) 91
Tsp45I GTSAC 5 cut(s) 3, 334, 349, 374, 646
TspDTI ATGAA 2 cut(s) 86, 668
TspGWI ACGGA 1 cut(s) 208
TspRI CASTG 2 cut(s) 63, 673
XapI RAATTY 1 cut(s) 457
XceI RCATGY 2 cut(s) 587, 675
XmnI GAANNNNTTC 2 cut(s) 200, 606
XspI CTAG 1 cut(s) 276
ZraI GACGTC 1 cut(s) 552
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.