Rmu_co8318615.1_g000001

Universal stress protein family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8318615.1
Physical Location & Seq
Forward (+)
1 .. 702
702 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8318615.1_g000001.1.cds

Sequence Viewer

Length: 367 bp
caatggctgtgaagaacctgtgatccataaggatgtaaagtcttccaacatccttctttcagatgattttgagccacagctctcagattttggacttgcgagtttggcatcgacgtcaatgcatattgattgcacggatgttgctggaacatttggttacttggctccagaatacttcatgcatggcaaggttagtgataaaattgatgtctatgcctttggtgtggtactccttgagcttctttctggtagacaaccaatctacagcaaatgtgcaaaggaccaggaaagtctggtgatgtgggcaaagccaatactgaagcgtgggggaggttgcccaactgctagatccaagcctgggaagtga

Protein Analysis

121

Amino Acids

13.14

Weight (kDa)

5.88

Isoelectric Point (pI)

55.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 117
AccI GTMKAC 1 cut(s) 251
AclWI GGATC 2 cut(s) 17, 343
AcuI CTGAAG 1 cut(s) 339
AcyI GRCGYC 1 cut(s) 114
AfaI GTAC 1 cut(s) 229
AfiI CCNNNNNNNGG 1 cut(s) 358
AjnI CCWGG 2 cut(s) 283, 356
AloI GAACNNNNNNTCC 2 cut(s) 7, 39
AluBI AGCT 2 cut(s) 80, 239
AluI AGCT 2 cut(s) 80, 239
AlwI GGATC 2 cut(s) 17, 343
AspS9I GGNCC 1 cut(s) 281
AsuHPI GGTGA 1 cut(s) 308
AvaII GGWCC 1 cut(s) 281
BbsI GAAGAC 1 cut(s) 34
BcgI CGANNNNNNTGC 2 cut(s) 101, 135
BciT130I CCWGG 2 cut(s) 285, 358
BfaI CTAG 1 cut(s) 346
BfmI CTRYAG 1 cut(s) 263
Bme1390I CCNGG 2 cut(s) 285, 358
Bme18I GGWCC 1 cut(s) 281
BmgT120I GGNCC 1 cut(s) 281
BmiI GGNNCC 1 cut(s) 166
BmrFI CCNGG 2 cut(s) 285, 358
BmsI GCATC 1 cut(s) 117
BpiI GAAGAC 1 cut(s) 34
BpmI CTGGAG 1 cut(s) 151
BpuEI CTTGAG 1 cut(s) 255
BsaHI GRCGYC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 357
Bsc4I CCNNNNNNNGG 1 cut(s) 358
BseBI CCWGG 2 cut(s) 285, 358
BseDI CCNNGG 1 cut(s) 357
BseGI GGATG 3 cut(s) 38, 49, 143
BseLI CCNNNNNNNGG 1 cut(s) 358
BseMII CTCAG 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 358
Bsp143I GATC 2 cut(s) 22, 348
BspCNI CTCAG 1 cut(s) 96
BspLI GGNNCC 1 cut(s) 166
BspPI GGATC 2 cut(s) 17, 343
BssECI CCNNGG 1 cut(s) 357
BssMI GATC 2 cut(s) 22, 348
BssNI GRCGYC 1 cut(s) 114
Bst2UI CCWGG 2 cut(s) 285, 358
BstACI GRCGYC 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 83
BstF5I GGATG 3 cut(s) 38, 49, 143
BstKTI GATC 2 cut(s) 25, 351
BstMBI GATC 2 cut(s) 22, 348
BstMWI GCNNNNNNNGC 1 cut(s) 105
BstNI CCWGG 2 cut(s) 285, 358
BstSCI CCNGG 2 cut(s) 283, 356
BstSFI CTRYAG 1 cut(s) 263
BstV2I GAAGAC 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 348
BstYI RGATCY 1 cut(s) 348
BtsCI GGATG 3 cut(s) 38, 49, 143
Cfr13I GGNCC 1 cut(s) 281
Csp6I GTAC 1 cut(s) 228
CviAII CATG 2 cut(s) 179, 183
CviJI RGCY 7 cut(s) 7, 74, 80, 165, 239, 311, 356
CviKI_1 RGCY 7 cut(s) 7, 74, 80, 165, 239, 311, 356
CviQI GTAC 1 cut(s) 228
DdeI CTNAG 1 cut(s) 83
DpnI GATC 2 cut(s) 24, 350
DpnII GATC 2 cut(s) 22, 348
Eco47I GGWCC 1 cut(s) 281
Eco57I CTGAAG 1 cut(s) 339
EcoRII CCWGG 2 cut(s) 283, 356
EcoT22I ATGCAT 2 cut(s) 124, 184
FaeI CATG 2 cut(s) 182, 186
FaiI YATR 5 cut(s) 28, 124, 180, 184, 214
FatI CATG 2 cut(s) 178, 182
FblI GTMKAC 1 cut(s) 251
FokI GGATG 3 cut(s) 36, 45, 150
FspBI CTAG 1 cut(s) 346
GsuI CTGGAG 1 cut(s) 151
Hin1I GRCGYC 1 cut(s) 114
Hin1II CATG 2 cut(s) 182, 186
HphI GGTGA 1 cut(s) 308
Hpy166II GTNNAC 1 cut(s) 252
Hpy188I TCNGA 2 cut(s) 62, 86
Hpy188III TCNNGA 1 cut(s) 168
Hpy8I GTNNAC 1 cut(s) 252
Hpy99I CGWCG 1 cut(s) 116
HpyAV CCTTC 1 cut(s) 63
HpyCH4IV ACGT 1 cut(s) 114
HpyCH4V TGCA 4 cut(s) 122, 133, 182, 276
HpyF10VI GCNNNNNNNGC 1 cut(s) 105
HpyF3I CTNAG 1 cut(s) 83
HpySE526I ACGT 1 cut(s) 114
Hsp92I GRCGYC 1 cut(s) 114
Hsp92II CATG 2 cut(s) 182, 186
Kzo9I GATC 2 cut(s) 22, 348
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 8 cut(s) 31, 130, 181, 232, 270, 279, 297, 343
LweI GCATC 1 cut(s) 117
MaeI CTAG 1 cut(s) 346
MaeII ACGT 1 cut(s) 114
MaeIII GTNAC 1 cut(s) 156
MalI GATC 2 cut(s) 24, 350
MboI GATC 2 cut(s) 22, 348
MboII GAAGA 2 cut(s) 24, 34
MflI RGATCY 1 cut(s) 348
MluCI AATT 1 cut(s) 202
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 1 cut(s) 324
Mph1103I ATGCAT 2 cut(s) 124, 184
MslI CAYNNNNRTG 1 cut(s) 31
MspR9I CCNGG 2 cut(s) 285, 358
MvaI CCWGG 2 cut(s) 285, 358
MwoI GCNNNNNNNGC 1 cut(s) 105
NdeII GATC 2 cut(s) 22, 348
NlaIII CATG 2 cut(s) 182, 186
NlaIV GGNNCC 1 cut(s) 166
NsiI ATGCAT 2 cut(s) 124, 184
Psp6I CCWGG 2 cut(s) 283, 356
PspGI CCWGG 2 cut(s) 283, 356
PspN4I GGNNCC 1 cut(s) 166
PspPI GGNCC 1 cut(s) 281
PsuI RGATCY 1 cut(s) 348
RsaI GTAC 1 cut(s) 229
RsaNI GTAC 1 cut(s) 228
RseI CAYNNNNRTG 1 cut(s) 31
Sau3AI GATC 2 cut(s) 22, 348
Sau96I GGNCC 1 cut(s) 281
ScrFI CCNGG 2 cut(s) 285, 358
SetI ASST 6 cut(s) 20, 82, 117, 193, 241, 335
SfaNI GCATC 1 cut(s) 117
SfcI CTRYAG 1 cut(s) 263
SinI GGWCC 1 cut(s) 281
SmiMI CAYNNNNRTG 1 cut(s) 31
SmlI CTYRAG 1 cut(s) 234
SmoI CTYRAG 1 cut(s) 234
Sse9I AATT 1 cut(s) 202
SspMI CTAG 1 cut(s) 346
StyD4I CCNGG 2 cut(s) 283, 356
TaiI ACGT 1 cut(s) 117
TaqI TCGA 1 cut(s) 111
TasI AATT 1 cut(s) 202
TspDTI ATGAA 1 cut(s) 167
TspGWI ACGGA 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 281
XmiI GTMKAC 1 cut(s) 251
XspI CTAG 1 cut(s) 346
ZraI GACGTC 1 cut(s) 115
Zsp2I ATGCAT 2 cut(s) 124, 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.