Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8318911.1

Orthogroup ID

OG0006392

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 714

Gene Structure 713 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8318911.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 598 bp

ctgtttgaagatgaagctaatgcagacaagtacaacagtctcagttttgttcatagggaagacagtaatggacgaaagtcatcgagccgaagtcatagaaatccaaaaactgagttatggcctgagtctgatcagacaaagaaatcagactattttggattctttagctgccagaatgcacctactgaatgcctagtgaataggaatctcatatttaagagtaattcagttcaacaagaagacaattcccaccttccttcaagcaatttaggcagtgcaatcagtactctttactcgtcggatagtctcagtgattgcgaaattgcagttcgtgcaattaccaaagcttggttggactcacatggtgatcctgtcattgaagccatgttatccgagccacctcttatccagggaatgctggaggtgttgtttgcttccactgatgatgaaattttggaactagtaatatcggttttagctgaatttgtagcaagaaatgagcagaatagaaagataatactgaattttgatccacagcttgaaatcttcatgagacttctaagaagtagtggtctatttttgaaagcagctgttttgc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

199

Amino Acids

22.36

Weight (kDa)

4.86

Isoelectric Point (pI)

52.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006392)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g11960 FvH4_3g11960 FvH4_3g11960 FvH4_3g11960 FvH4_3g11960
malus_domestica	MD05G1256200.v1.1 MD10G1236500.v1.1 MD10G1236600.v1.1
prunus_persica	Prupe.4G107900_v2.0.a1 Prupe.4G107900_v2.0.a1 Prupe.4G107900_v2.0.a1
pyrus_communis	pycom05g23530 pycom10g19790
rosa_chinensis	RchiOBHm_Chr5g0019541
rosa_laevigata	RLG00000032455
rosa_multiflora	Rmu_co8318911.1_g000001 Rmu_sc0002759.1_g000051 Rmu_sc0002759.1_g000053
rosa_roxburghii	Rroxscaffold_1G00058520
rosa_rugosa	Rorug05G0051700 Rorug05G0051800 Rorug05G0051900
rosa_samantha	Rh5AG142500 Rh5BG140900 Rh5CG153000 Rh5DG141600
rosa_wichuraiana	Rw5G012610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	348
AclWI	GGATC	2 cut(s)	362, 524
AcsI	RAATTY	3 cut(s)	450, 482, 523
AdeI	CACNNNGTG	1 cut(s)	365
AfaI	GTAC	2 cut(s)	32, 286
AfiI	CCNNNNNNNGG	1 cut(s)	348
AgsI	TTSAA	6 cut(s)	8, 233, 261, 380, 542, 583
AhlI	ACTAGT	1 cut(s)	460
AjnI	CCWGG	1 cut(s)	408
AluBI	AGCT	6 cut(s)	17, 168, 347, 479, 538, 590
AluI	AGCT	6 cut(s)	17, 168, 347, 479, 538, 590
Alw26I	GTCTC	3 cut(s)	44, 311, 547
AlwI	GGATC	2 cut(s)	362, 524
AoxI	GGCC	1 cut(s)	119
ApeKI	GCWGC	2 cut(s)	168, 587
ApoI	RAATTY	3 cut(s)	450, 482, 523
AsuHPI	GGTGA	1 cut(s)	377
BbsI	GAAGAC	2 cut(s)	66, 246
BbvI	GCAGC	1 cut(s)	155
BciT130I	CCWGG	1 cut(s)	410
BclI	TGATCA	1 cut(s)	130
BcoDI	GTCTC	3 cut(s)	44, 311, 547
BcuI	ACTAGT	1 cut(s)	460
BfaI	CTAG	2 cut(s)	194, 461
BisI	GCNGC	2 cut(s)	169, 588
BlsI	GCNGC	2 cut(s)	170, 589
BmcAI	AGTACT	1 cut(s)	286
Bme1390I	CCNGG	1 cut(s)	410
BmrFI	CCNGG	1 cut(s)	410
BoxI	GACNNNNGTC	1 cut(s)	76
BpiI	GAAGAC	2 cut(s)	66, 246
BpmI	CTGGAG	1 cut(s)	440
BsaJI	CCNNGG	1 cut(s)	409
BsaXI	ACNNNNNCTCC	2 cut(s)	413, 443
Bsc4I	CCNNNNNNNGG	1 cut(s)	348
BseBI	CCWGG	1 cut(s)	410
BseDI	CCNNGG	1 cut(s)	409
BseLI	CCNNNNNNNGG	1 cut(s)	348
BseMII	CTCAG	4 cut(s)	55, 102, 114, 322
BseXI	GCAGC	1 cut(s)	155
BshFI	GGCC	1 cut(s)	121
BslI	CCNNNNNNNGG	1 cut(s)	348
BsmAI	GTCTC	3 cut(s)	44, 311, 547
BsmI	GAATGC	3 cut(s)	181, 194, 420
BsnI	GGCC	1 cut(s)	121
Bsp143I	GATC	3 cut(s)	130, 367, 529
BspANI	GGCC	1 cut(s)	121
BspCNI	CTCAG	4 cut(s)	54, 103, 115, 321
BspHI	TCATGA	1 cut(s)	549
BspPI	GGATC	2 cut(s)	362, 524
BssECI	CCNNGG	1 cut(s)	409
BssMI	GATC	3 cut(s)	130, 367, 529
Bst2UI	CCWGG	1 cut(s)	410
Bst4CI	ACNGT	2 cut(s)	38, 65
BstAPI	GCANNNNNTGC	1 cut(s)	332
BstDEI	CTNAG	5 cut(s)	41, 111, 123, 308, 560
BstKTI	GATC	3 cut(s)	133, 370, 532
BstMAI	GTCTC	3 cut(s)	44, 311, 547
BstMBI	GATC	3 cut(s)	130, 367, 529
BstMWI	GCNNNNNNNGC	2 cut(s)	270, 332
BstNI	CCWGG	1 cut(s)	410
BstPAI	GACNNNNGTC	1 cut(s)	76
BstSCI	CCNGG	1 cut(s)	408
BstV1I	GCAGC	1 cut(s)	155
BstV2I	GAAGAC	2 cut(s)	66, 246
BsuRI	GGCC	1 cut(s)	121
BtsI	GCAGTG	1 cut(s)	280
BtsIMutI	CAGTG	3 cut(s)	280, 316, 438
CciI	TCATGA	1 cut(s)	549
Csp6I	GTAC	2 cut(s)	31, 285
CviAII	CATG	3 cut(s)	362, 385, 550
CviQI	GTAC	2 cut(s)	31, 285
DdeI	CTNAG	5 cut(s)	41, 111, 123, 308, 560
DpnI	GATC	3 cut(s)	132, 369, 531
DpnII	GATC	3 cut(s)	130, 367, 529
DraIII	CACNNNGTG	1 cut(s)	365
EcoRII	CCWGG	1 cut(s)	408
FaeI	CATG	3 cut(s)	365, 388, 553
FaiI	YATR	7 cut(s)	54, 96, 118, 212, 363, 386, 551
FatI	CATG	3 cut(s)	361, 384, 549
FbaI	TGATCA	1 cut(s)	130
Fnu4HI	GCNGC	2 cut(s)	169, 588
Fsp4HI	GCNGC	2 cut(s)	169, 588
FspBI	CTAG	2 cut(s)	194, 461
GluI	GCNGC	2 cut(s)	169, 588
GsuI	CTGGAG	1 cut(s)	440
HaeIII	GGCC	1 cut(s)	121
Hin1II	CATG	3 cut(s)	365, 388, 553
HindIII	AAGCTT	1 cut(s)	345
HinfI	GANTC	4 cut(s)	125, 159, 205, 356
HphI	GGTGA	1 cut(s)	377
Hpy188I	TCNGA	5 cut(s)	130, 135, 148, 301, 394
Hpy188III	TCNNGA	1 cut(s)	550
Hpy99I	CGWCG	1 cut(s)	301
HpyAV	CCTTC	2 cut(s)	263, 267
HpyCH4III	ACNGT	2 cut(s)	38, 65
HpyCH4V	TGCA	5 cut(s)	23, 179, 278, 326, 335
HpyF10VI	GCNNNNNNNGC	2 cut(s)	270, 332
HpyF3I	CTNAG	5 cut(s)	41, 111, 123, 308, 560
Hsp92II	CATG	3 cut(s)	365, 388, 553
Ksp22I	TGATCA	1 cut(s)	130
Kzo9I	GATC	3 cut(s)	130, 367, 529
LpnPI	CCDG	6 cut(s)	135, 185, 384, 395, 404, 422
Lsp1109I	GCAGC	1 cut(s)	155
MaeI	CTAG	2 cut(s)	194, 461
MalI	GATC	3 cut(s)	132, 369, 531
MboI	GATC	3 cut(s)	130, 367, 529
MboII	GAAGA	4 cut(s)	20, 71, 251, 538
MluCI	AATT	8 cut(s)	223, 244, 265, 321, 336, 450, 482, 523
MlyI	GAGTC	2 cut(s)	134, 350
MmeI	TCCRAC	2 cut(s)	279, 333
MnlI	CCTC	2 cut(s)	411, 415
MseI	TTAA	1 cut(s)	216
MspA1I	CMGCKG	1 cut(s)	590
MspR9I	CCNGG	1 cut(s)	410
Mva1269I	GAATGC	3 cut(s)	181, 194, 420
MvaI	CCWGG	1 cut(s)	410
MwoI	GCNNNNNNNGC	2 cut(s)	270, 332
NdeII	GATC	3 cut(s)	130, 367, 529
NlaIII	CATG	3 cut(s)	365, 388, 553
PagI	TCATGA	1 cut(s)	549
PctI	GAATGC	3 cut(s)	181, 194, 420
PfeI	GAWTC	2 cut(s)	159, 205
PflMI	CCANNNNNTGG	1 cut(s)	348
PkrI	GCNGC	2 cut(s)	170, 589
PleI	GAGTC	2 cut(s)	133, 350
PpsI	GAGTC	2 cut(s)	133, 350
PshAI	GACNNNNGTC	1 cut(s)	76
Psp6I	CCWGG	1 cut(s)	408
PspGI	CCWGG	1 cut(s)	408
PvuII	CAGCTG	1 cut(s)	590
RsaI	GTAC	2 cut(s)	32, 286
RsaNI	GTAC	2 cut(s)	31, 285
SaqAI	TTAA	1 cut(s)	216
SatI	GCNGC	2 cut(s)	169, 588
Sau3AI	GATC	3 cut(s)	130, 367, 529
ScaI	AGTACT	1 cut(s)	286
SchI	GAGTC	2 cut(s)	134, 350
ScrFI	CCNGG	1 cut(s)	410
SpeI	ACTAGT	1 cut(s)	460
Sse9I	AATT	8 cut(s)	223, 244, 265, 321, 336, 450, 482, 523
SspMI	CTAG	2 cut(s)	194, 461
StyD4I	CCNGG	1 cut(s)	408
TaaI	ACNGT	2 cut(s)	38, 65
TaqI	TCGA	1 cut(s)	83
TasI	AATT	8 cut(s)	223, 244, 265, 321, 336, 450, 482, 523
TatI	WGTACW	2 cut(s)	30, 284
TfiI	GAWTC	2 cut(s)	159, 205
Tru1I	TTAA	1 cut(s)	216
Tru9I	TTAA	1 cut(s)	216
TscAI	CASTG	3 cut(s)	280, 316, 445
TseI	GCWGC	2 cut(s)	168, 587
TspDTI	ATGAA	4 cut(s)	27, 41, 462, 538
TspRI	CASTG	3 cut(s)	280, 316, 445
Van91I	CCANNNNNTGG	1 cut(s)	348
XapI	RAATTY	3 cut(s)	450, 482, 523
XcmI	CCANNNNNNNNNTGG	1 cut(s)	349
XspI	CTAG	2 cut(s)	194, 461
ZrmI	AGTACT	1 cut(s)	286

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.