Rmu_co8328357.1_g000001

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8328357.1
OG0016373
Physical Location & Seq
Forward (+)
8 .. 967
960 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8328357.1_g000001.1.cds

Sequence Viewer

Length: 960 bp
atggctgtgtttcgaggtatacagaggaagaaagtggggcattggacggctataattgttggtttaggaatgcatggtatggctgaccaggttcttcagctgtttctggaaatgcgcaaaaatgggatggagcctcatgctataacttttgttggaatcttgaatgcatgtagccatgctggattggtcgatcttggacgttactatttcaatatgatgataaaggattatggaattgaacccacaattgagcactatggttgctttgtagacattttatgtcgagctggctgtttggacgaggcaaagaatgtcattgggagtatgccaatgaaaccaaacaaagttatttggatgagtttacttagtggtgcccggatccatggaaatgttgaaattggtgattatgcagctcaacatttgatagaggtgtctccagatactattggatgctacgttgtgctctctaacatgtatgctgcagctgatcagtgggagaaagtttcacaggtaagagaaatgatgaaaaagagaggtgtcaaaaaggacccaggatgcagtagcatagagcacagaggtatgcttcatgagtttattgttggtgacaaatcccatcctcagacaaaagagatatattccaagttgagtgaggtgagagagaaactaaaatctgcaggacatgttcctgacacaagccaagttttattgtgtcttgaggatgaaaaggagaaggaagctgaactggaaaaccatagtgagagattggctattgcatttggtctaattaatttggaacctaggagtcctattcgcatcataaagaatcttcgtgtctgtaatgattgccattctgtcactaaactcctttccaagatctataatcgtgagattgttgtcagagataatagccgtttccatcacttcgccaatgggtcatgttcttgcaaagatttttggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR

Protein Analysis

319

Amino Acids

36.03

Weight (kDa)

7.98

Isoelectric Point (pI)

33.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016373)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g41070
malus_domestica MD09G1122400.v1.1 MD17G1113300.v1.1
prunus_persica Prupe.3G201100_v2.0.a1
pyrus_communis pycom09g04680
rosa_chinensis RchiOBHm_Chr2g0156631
rosa_laevigata RLG00000020926
rosa_multiflora Rmu_co8328357.1_g000001
rosa_roxburghii Rroxscaffold_2G00092890
rosa_rugosa Rorug02G0454800
rosa_samantha Rh2AG520400 Rh2BG533400 Rh2CG505400 Rh2DG542200
rosa_wichuraiana Rw2G042940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 116
AccB1I GGYRCC 1 cut(s) 371
AccI GTMKAC 2 cut(s) 19, 270
AclWI GGATC 2 cut(s) 373, 386
AcuI CTGAAG 1 cut(s) 80
AflIII ACRYGT 2 cut(s) 471, 679
AgsI TTSAA 4 cut(s) 163, 211, 239, 395
AjnI CCWGG 2 cut(s) 87, 550
AluBI AGCT 5 cut(s) 100, 287, 413, 485, 737
AluI AGCT 5 cut(s) 100, 287, 413, 485, 737
Alw21I GWGCWC 3 cut(s) 255, 465, 573
Alw26I GTCTC 1 cut(s) 438
AlwI GGATC 2 cut(s) 373, 386
ApeKI GCWGC 3 cut(s) 410, 479, 482
AseI ATTAAT 1 cut(s) 786
AspA2I CCTAGG 1 cut(s) 797
AspLEI GCGC 1 cut(s) 117
AspS9I GGNCC 1 cut(s) 547
AsuC2I CCSGG 1 cut(s) 376
AsuHPI GGTGA 3 cut(s) 413, 614, 664
AvaII GGWCC 1 cut(s) 547
AvrII CCTAGG 1 cut(s) 797
BaeGI GKGCMC 1 cut(s) 376
BamHI GGATCC 1 cut(s) 378
BanI GGYRCC 1 cut(s) 371
Bbv12I GWGCWC 3 cut(s) 255, 465, 573
BbvI GCAGC 3 cut(s) 422, 466, 494
BccI CCATC 3 cut(s) 121, 621, 924
BceAI ACGGC 2 cut(s) 63, 894
BciT130I CCWGG 2 cut(s) 89, 552
BclI TGATCA 1 cut(s) 487
BcnI CCSGG 1 cut(s) 376
BcoDI GTCTC 1 cut(s) 438
BfaI CTAG 1 cut(s) 798
BfmI CTRYAG 2 cut(s) 480, 672
BglII AGATCT 1 cut(s) 873
BisI GCNGC 3 cut(s) 411, 480, 483
BlnI CCTAGG 1 cut(s) 797
BlsI GCNGC 3 cut(s) 412, 481, 484
Bme1390I CCNGG 3 cut(s) 89, 376, 552
Bme18I GGWCC 1 cut(s) 547
BmgT120I GGNCC 1 cut(s) 547
BmiI GGNNCC 5 cut(s) 132, 373, 380, 549, 795
BmrFI CCNGG 3 cut(s) 89, 376, 552
BmsI GCATC 3 cut(s) 440, 545, 822
BpmI CTGGAG 1 cut(s) 420
BpuEI CTTGAG 1 cut(s) 734
BpuMI CCSGG 1 cut(s) 376
BsaJI CCNNGG 3 cut(s) 382, 550, 797
Bse1I ACTGG 1 cut(s) 747
BseBI CCWGG 2 cut(s) 89, 552
BseDI CCNNGG 3 cut(s) 382, 550, 797
BseGI GGATG 6 cut(s) 132, 360, 455, 560, 613, 724
BseMII CTCAG 1 cut(s) 632
BseNI ACTGG 1 cut(s) 747
BseSI GKGCMC 1 cut(s) 376
BseXI GCAGC 3 cut(s) 422, 466, 494
BshNI GGYRCC 1 cut(s) 371
BsiHKAI GWGCWC 3 cut(s) 255, 465, 573
BsiSI CCGG 1 cut(s) 376
BsmAI GTCTC 1 cut(s) 438
BsmI GAATGC 2 cut(s) 75, 169
Bsp1286I GDGCHC 4 cut(s) 255, 376, 465, 573
Bsp143I GATC 4 cut(s) 190, 378, 487, 873
Bsp19I CCATGG 1 cut(s) 382
BspCNI CTCAG 1 cut(s) 631
BspHI TCATGA 1 cut(s) 586
BspLI GGNNCC 5 cut(s) 132, 373, 380, 549, 795
BspMAI CTGCAG 2 cut(s) 484, 676
BspPI GGATC 2 cut(s) 373, 386
BspT107I GGYRCC 1 cut(s) 371
BsrI ACTGG 1 cut(s) 747
BssECI CCNNGG 3 cut(s) 382, 550, 797
BssMI GATC 4 cut(s) 190, 378, 487, 873
BssNAI GTATAC 1 cut(s) 20
BssT1I CCWWGG 2 cut(s) 382, 797
Bst1107I GTATAC 1 cut(s) 20
Bst2UI CCWGG 2 cut(s) 89, 552
BstC8I GCNNGC 1 cut(s) 289
BstDEI CTNAG 2 cut(s) 365, 618
BstDSI CCRYGG 1 cut(s) 382
BstF5I GGATG 6 cut(s) 132, 360, 455, 560, 613, 724
BstHHI GCGC 1 cut(s) 117
BstKTI GATC 4 cut(s) 193, 381, 490, 876
BstMAI GTCTC 1 cut(s) 438
BstMBI GATC 4 cut(s) 190, 378, 487, 873
BstNI CCWGG 2 cut(s) 89, 552
BstNSI RCATGY 3 cut(s) 171, 475, 683
BstSCI CCNGG 3 cut(s) 87, 374, 550
BstSFI CTRYAG 2 cut(s) 480, 672
BstSLI GKGCMC 1 cut(s) 376
BstV1I GCAGC 3 cut(s) 422, 466, 494
BstX2I RGATCY 2 cut(s) 378, 873
BstYI RGATCY 2 cut(s) 378, 873
BstZ17I GTATAC 1 cut(s) 20
BtgI CCRYGG 1 cut(s) 382
BtsCI GGATG 6 cut(s) 132, 360, 455, 560, 613, 724
BtsIMutI CAGTG 1 cut(s) 497
Cac8I GCNNGC 1 cut(s) 289
CciI TCATGA 1 cut(s) 586
CfoI GCGC 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 547
CsiI ACCWGGT 1 cut(s) 87
CviAII CATG 9 cut(s) 74, 137, 168, 176, 383, 472, 587, 680, 936
DdeI CTNAG 2 cut(s) 365, 618
DpnI GATC 4 cut(s) 192, 380, 489, 875
DpnII GATC 4 cut(s) 190, 378, 487, 873
Eco130I CCWWGG 2 cut(s) 382, 797
Eco47I GGWCC 1 cut(s) 547
Eco57I CTGAAG 1 cut(s) 80
EcoO109I RGGNCCY 1 cut(s) 547
EcoRII CCWGG 2 cut(s) 87, 550
EcoT14I CCWWGG 2 cut(s) 382, 797
EcoT22I ATGCAT 2 cut(s) 75, 169
ErhI CCWWGG 2 cut(s) 382, 797
FaeI CATG 9 cut(s) 77, 140, 171, 179, 386, 475, 590, 683, 939
FatI CATG 9 cut(s) 73, 136, 167, 175, 382, 471, 586, 679, 935
FbaI TGATCA 1 cut(s) 487
FblI GTMKAC 2 cut(s) 19, 270
Fnu4HI GCNGC 3 cut(s) 411, 480, 483
FokI GGATG 6 cut(s) 139, 367, 462, 567, 600, 731
Fsp4HI GCNGC 3 cut(s) 411, 480, 483
FspBI CTAG 1 cut(s) 798
FspI TGCGCA 1 cut(s) 116
GlaI GCGC 1 cut(s) 116
GluI GCNGC 3 cut(s) 411, 480, 483
GsuI CTGGAG 1 cut(s) 420
HapII CCGG 1 cut(s) 376
HhaI GCGC 1 cut(s) 117
Hin1II CATG 9 cut(s) 77, 140, 171, 179, 386, 475, 590, 683, 939
Hin6I GCGC 1 cut(s) 115
HinP1I GCGC 1 cut(s) 115
HinfI GANTC 3 cut(s) 156, 802, 823
HpaII CCGG 1 cut(s) 376
HphI GGTGA 3 cut(s) 413, 614, 664
Hpy166II GTNNAC 3 cut(s) 20, 271, 362
Hpy188I TCNGA 2 cut(s) 621, 899
Hpy188III TCNNGA 7 cut(s) 107, 160, 437, 587, 686, 713, 884
Hpy8I GTNNAC 3 cut(s) 20, 271, 362
HpyAV CCTTC 1 cut(s) 724
HpyCH4IV ACGT 2 cut(s) 199, 456
HpyCH4V TGCA 8 cut(s) 73, 167, 410, 482, 558, 674, 773, 945
HpyF3I CTNAG 2 cut(s) 365, 618
HpySE526I ACGT 2 cut(s) 199, 456
Hsp92II CATG 9 cut(s) 77, 140, 171, 179, 386, 475, 590, 683, 939
HspAI GCGC 1 cut(s) 115
Ksp22I TGATCA 1 cut(s) 487
Kzo9I GATC 4 cut(s) 190, 378, 487, 873
LmnI GCTCC 1 cut(s) 130
Lsp1109I GCAGC 3 cut(s) 422, 466, 494
LweI GCATC 3 cut(s) 440, 545, 822
MabI ACCWGGT 1 cut(s) 87
MaeI CTAG 1 cut(s) 798
MaeII ACGT 2 cut(s) 199, 456
MaeIII GTNAC 3 cut(s) 200, 602, 853
MalI GATC 4 cut(s) 192, 380, 489, 875
MboI GATC 4 cut(s) 190, 378, 487, 873
MboII GAAGA 3 cut(s) 40, 86, 818
MfeI CAATTG 1 cut(s) 246
MflI RGATCY 2 cut(s) 378, 873
MhlI GDGCHC 4 cut(s) 255, 376, 465, 573
MluCI AATT 6 cut(s) 54, 234, 246, 396, 783, 787
MlyI GAGTC 1 cut(s) 811
MmeI TCCRAC 1 cut(s) 133
Mph1103I ATGCAT 2 cut(s) 75, 169
MseI TTAA 1 cut(s) 786
MslI CAYNNNNRTG 1 cut(s) 387
MspA1I CMGCKG 2 cut(s) 100, 485
MspI CCGG 1 cut(s) 376
MspR9I CCNGG 3 cut(s) 89, 376, 552
MunI CAATTG 1 cut(s) 246
Mva1269I GAATGC 2 cut(s) 75, 169
MvaI CCWGG 2 cut(s) 89, 552
NciI CCSGG 1 cut(s) 376
NcoI CCATGG 1 cut(s) 382
NdeII GATC 4 cut(s) 190, 378, 487, 873
NlaIII CATG 9 cut(s) 77, 140, 171, 179, 386, 475, 590, 683, 939
NlaIV GGNNCC 5 cut(s) 132, 373, 380, 549, 795
NmuCI GTSAC 2 cut(s) 602, 853
NsbI TGCGCA 1 cut(s) 116
NsiI ATGCAT 2 cut(s) 75, 169
NspI RCATGY 3 cut(s) 171, 475, 683
PagI TCATGA 1 cut(s) 586
PciI ACATGT 2 cut(s) 471, 679
PctI GAATGC 2 cut(s) 75, 169
PfeI GAWTC 2 cut(s) 156, 823
PkrI GCNGC 3 cut(s) 412, 481, 484
PleI GAGTC 1 cut(s) 810
PpsI GAGTC 1 cut(s) 810
PpuMI RGGWCCY 1 cut(s) 547
PscI ACATGT 2 cut(s) 471, 679
PshBI ATTAAT 1 cut(s) 786
Psp5II RGGWCCY 1 cut(s) 547
Psp6I CCWGG 2 cut(s) 87, 550
PspGI CCWGG 2 cut(s) 87, 550
PspN4I GGNNCC 5 cut(s) 132, 373, 380, 549, 795
PspPI GGNCC 1 cut(s) 547
PspPPI RGGWCCY 1 cut(s) 547
PstI CTGCAG 2 cut(s) 484, 676
PsuI RGATCY 2 cut(s) 378, 873
PvuII CAGCTG 2 cut(s) 100, 485
RseI CAYNNNNRTG 1 cut(s) 387
SaqAI TTAA 1 cut(s) 786
SatI GCNGC 3 cut(s) 411, 480, 483
Sau3AI GATC 4 cut(s) 190, 378, 487, 873
Sau96I GGNCC 1 cut(s) 547
SchI GAGTC 1 cut(s) 811
ScrFI CCNGG 3 cut(s) 89, 376, 552
SduI GDGCHC 4 cut(s) 255, 376, 465, 573
SexAI ACCWGGT 1 cut(s) 87
SfaNI GCATC 3 cut(s) 440, 545, 822
SfcI CTRYAG 2 cut(s) 480, 672
SinI GGWCC 1 cut(s) 547
SmiMI CAYNNNNRTG 1 cut(s) 387
SmlI CTYRAG 1 cut(s) 713
SmoI CTYRAG 1 cut(s) 713
Sse9I AATT 6 cut(s) 54, 234, 246, 396, 783, 787
SspMI CTAG 1 cut(s) 798
StyD4I CCNGG 3 cut(s) 87, 374, 550
StyI CCWWGG 2 cut(s) 382, 797
TaiI ACGT 2 cut(s) 202, 459
TaqI TCGA 3 cut(s) 13, 189, 283
TasI AATT 6 cut(s) 54, 234, 246, 396, 783, 787
TfiI GAWTC 2 cut(s) 156, 823
Tru1I TTAA 1 cut(s) 786
Tru9I TTAA 1 cut(s) 786
TscAI CASTG 1 cut(s) 497
TseFI GTSAC 2 cut(s) 602, 853
TseI GCWGC 3 cut(s) 410, 479, 482
Tsp45I GTSAC 2 cut(s) 602, 853
TspDTI ATGAA 4 cut(s) 347, 539, 575, 735
TspRI CASTG 1 cut(s) 497
VpaK11BI GGWCC 1 cut(s) 547
VspI ATTAAT 1 cut(s) 786
XceI RCATGY 3 cut(s) 171, 475, 683
XmaJI CCTAGG 1 cut(s) 797
XmiI GTMKAC 2 cut(s) 19, 270
XspI CTAG 1 cut(s) 798
Zsp2I ATGCAT 2 cut(s) 75, 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.