Rmu_co8339943.1_g000001

Belongs to the multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8339943.1
OG0007977
Physical Location & Seq
Reverse (-)
2 .. 818
817 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8339943.1_g000001.1.cds

Sequence Viewer

Length: 379 bp
atggcagctagggagggccctgtacctatggctggtcatcagatttgcattcaagtttggctggcagtatcgttgcttactgatgcattagctcttgctggtcagacacttcttgccagtggttattcccaaaagaattatgaagaagcacgccaagtggtttacaaagctctacagctaggtttagtgatgggaattggtttgtctggcatattattcattggttttaaaccgttttctggcttattcagcacagacacagaagtcctagcaattgcatgttctggtctattgtttgttgccggatctcagccgtttaacgctatagcatttgttcttgatgggctgtactatggagtttcagactttgaatttgctg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MIF MatE

Protein Analysis

126

Amino Acids

13.34

Weight (kDa)

4.6

Isoelectric Point (pI)

28.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 263
AclWI GGATC 1 cut(s) 313
AcsI RAATTY 1 cut(s) 371
AfaI GTAC 2 cut(s) 24, 350
AfiI CCNNNNNNNGG 2 cut(s) 32, 239
AgsI TTSAA 2 cut(s) 53, 371
AluBI AGCT 4 cut(s) 8, 92, 170, 178
AluI AGCT 4 cut(s) 8, 92, 170, 178
AlwI GGATC 1 cut(s) 313
AoxI GGCC 1 cut(s) 16
ApaI GGGCCC 1 cut(s) 20
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 371
ArsI GACNNNNNNTTYG 1 cut(s) 356
AspS9I GGNCC 2 cut(s) 16, 17
BaeGI GKGCMC 1 cut(s) 20
BanII GRGCYC 1 cut(s) 20
BbvI GCAGC 1 cut(s) 17
BccI CCATC 2 cut(s) 184, 335
BceAI ACGGC 1 cut(s) 298
BfaI CTAG 3 cut(s) 9, 179, 269
BfmI CTRYAG 2 cut(s) 173, 324
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BmgT120I GGNCC 2 cut(s) 16, 17
BmiI GGNNCC 1 cut(s) 18
BmsI GCATC 1 cut(s) 73
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 239
Bse1I ACTGG 1 cut(s) 117
BseLI CCNNNNNNNGG 2 cut(s) 32, 239
BseMII CTCAG 1 cut(s) 323
BseNI ACTGG 1 cut(s) 117
BseSI GKGCMC 1 cut(s) 20
BseXI GCAGC 1 cut(s) 17
BshFI GGCC 1 cut(s) 18
BsiSI CCGG 1 cut(s) 303
BslI CCNNNNNNNGG 2 cut(s) 32, 239
BsmI GAATGC 1 cut(s) 48
BsnI GGCC 1 cut(s) 18
Bsp120I GGGCCC 1 cut(s) 16
Bsp1286I GDGCHC 1 cut(s) 20
Bsp143I GATC 1 cut(s) 305
BspANI GGCC 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 322
BspLI GGNNCC 1 cut(s) 18
BspPI GGATC 1 cut(s) 313
BsrI ACTGG 1 cut(s) 117
BssMI GATC 1 cut(s) 305
Bst4CI ACNGT 1 cut(s) 234
BstC8I GCNNGC 2 cut(s) 63, 151
BstDEI CTNAG 1 cut(s) 309
BstKTI GATC 1 cut(s) 308
BstMBI GATC 1 cut(s) 305
BstMWI GCNNNNNNNGC 1 cut(s) 249
BstNSI RCATGY 1 cut(s) 282
BstSFI CTRYAG 2 cut(s) 173, 324
BstSLI GKGCMC 1 cut(s) 20
BstV1I GCAGC 1 cut(s) 17
BstX2I RGATCY 1 cut(s) 305
BstYI RGATCY 1 cut(s) 305
BsuRI GGCC 1 cut(s) 18
BtsIMutI CAGTG 1 cut(s) 124
Cac8I GCNNGC 2 cut(s) 63, 151
Cfr13I GGNCC 2 cut(s) 16, 17
Csp6I GTAC 2 cut(s) 23, 349
CviAII CATG 1 cut(s) 279
CviQI GTAC 2 cut(s) 23, 349
DdeI CTNAG 1 cut(s) 309
DpnI GATC 1 cut(s) 307
DpnII GATC 1 cut(s) 305
DraI TTTAAA 1 cut(s) 229
DrdI GACNNNNNNGTC 1 cut(s) 263
DseDI GACNNNNNNGTC 1 cut(s) 263
Eco24I GRGCYC 1 cut(s) 20
EcoO109I RGGNCCY 2 cut(s) 16, 17
EcoT22I ATGCAT 1 cut(s) 88
EcoT38I GRGCYC 1 cut(s) 20
FaeI CATG 1 cut(s) 282
FaiI YATR 6 cut(s) 29, 141, 212, 280, 326, 354
FatI CATG 1 cut(s) 278
Fnu4HI GCNGC 1 cut(s) 6
FriOI GRGCYC 1 cut(s) 20
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 3 cut(s) 9, 179, 269
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 18
HapII CCGG 1 cut(s) 303
Hin1II CATG 1 cut(s) 282
HpaII CCGG 1 cut(s) 303
Hpy166II GTNNAC 1 cut(s) 163
Hpy188I TCNGA 3 cut(s) 42, 105, 364
Hpy188III TCNNGA 1 cut(s) 338
Hpy8I GTNNAC 1 cut(s) 163
HpyCH4III ACNGT 1 cut(s) 234
HpyCH4V TGCA 3 cut(s) 48, 86, 278
HpyF10VI GCNNNNNNNGC 1 cut(s) 249
HpyF3I CTNAG 1 cut(s) 309
Hsp92II CATG 1 cut(s) 282
Kzo9I GATC 1 cut(s) 305
LpnPI CCDG 9 cut(s) 18, 33, 47, 84, 130, 192, 225, 270, 316
Lsp1109I GCAGC 1 cut(s) 17
LweI GCATC 1 cut(s) 73
MaeI CTAG 3 cut(s) 9, 179, 269
MalI GATC 1 cut(s) 307
MboI GATC 1 cut(s) 305
MboII GAAGA 1 cut(s) 155
MfeI CAATTG 1 cut(s) 273
MflI RGATCY 1 cut(s) 305
MhlI GDGCHC 1 cut(s) 20
MluCI AATT 4 cut(s) 136, 195, 273, 371
MnlI CCTC 1 cut(s) 7
Mph1103I ATGCAT 1 cut(s) 88
MseI TTAA 2 cut(s) 228, 318
MspI CCGG 1 cut(s) 303
MunI CAATTG 1 cut(s) 273
Mva1269I GAATGC 1 cut(s) 48
MwoI GCNNNNNNNGC 1 cut(s) 249
NdeII GATC 1 cut(s) 305
NlaIII CATG 1 cut(s) 282
NlaIV GGNNCC 1 cut(s) 18
NsiI ATGCAT 1 cut(s) 88
NspI RCATGY 1 cut(s) 282
PctI GAATGC 1 cut(s) 48
PkrI GCNGC 1 cut(s) 7
PspN4I GGNNCC 1 cut(s) 18
PspOMI GGGCCC 1 cut(s) 16
PspPI GGNCC 2 cut(s) 16, 17
PsuI RGATCY 1 cut(s) 305
RsaI GTAC 2 cut(s) 24, 350
RsaNI GTAC 2 cut(s) 23, 349
SaqAI TTAA 2 cut(s) 228, 318
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 305
Sau96I GGNCC 2 cut(s) 16, 17
SduI GDGCHC 1 cut(s) 20
SetI ASST 6 cut(s) 10, 28, 94, 172, 180, 184
SfaNI GCATC 1 cut(s) 73
SfcI CTRYAG 2 cut(s) 173, 324
Sse9I AATT 4 cut(s) 136, 195, 273, 371
SspMI CTAG 3 cut(s) 9, 179, 269
TaaI ACNGT 1 cut(s) 234
TasI AATT 4 cut(s) 136, 195, 273, 371
TatI WGTACW 1 cut(s) 348
Tru1I TTAA 2 cut(s) 228, 318
Tru9I TTAA 2 cut(s) 228, 318
TscAI CASTG 1 cut(s) 124
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 2 cut(s) 156, 208
TspRI CASTG 1 cut(s) 124
XapI RAATTY 1 cut(s) 371
XceI RCATGY 1 cut(s) 282
XspI CTAG 3 cut(s) 9, 179, 269
Zsp2I ATGCAT 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.