Rmu_co8348659.1_g000001

Zeaxanthin epoxidase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8348659.1
OG0012103
Physical Location & Seq
Forward (+)
1 .. 1034
1034 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8348659.1_g000001.1.cds

Sequence Viewer

Length: 935 bp
agagcagcacattgggctgacctacatgctcttttatatcatgctttgccacctaacttgtttctttggggtcaccatttccaatctttctccatttctagtgacaagagatcagttcaagtgaaggctttatcccttcaaagtaacgagatcattgaaatcgttggggatttgcttgttgcggcagatgggtgtctctctaaaatccgccaaagctttgtgcctgatcataagctgaggtattcaggttattgtgcatggagaggggttcttgatttttcaggaaatgagaattccgaaaccataatggggatccgaaaggcataccctgaactcgggaaatgcttgtacttcggcttaggttctgggactcacactgtgctatacgagcttctgaacaataggctgaattggatttggtatgtccatcaaccagagcctgatctgaagggtaattcaatgaccacgaaggcaagcagcgacgtgatccaggcaatgcacaaagaagcagagaagatgtggcttcctgagttcgtgggagtaatcaaagaaacgagccaccctttcatcaatgccatatatgacagtgaacccttggagcaaatctattgggacaatgtggtattggttggagatgcagctcaccccacaactcctcatgcagtaagaagcacaaacatgtcggtcttggatgctgcggtgttaggccagtgcctgaagaagtggggtgcagaaaacttgcaatcagctcttgaagaatatcagtccattcggttaccagtcgtatcgaagcaagtccttcatgcaaggagaatggggaggattaaacaaggtcaagttcttcctgaccgacagtcttttgaccccaagaaggctgatccagaggagtgccaagagcttcaacagaaactcatgccttttttctctgacgttcc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAD_binding_3 NAD_binding_8

Protein Analysis

312

Amino Acids

35.28

Weight (kDa)

6.37

Isoelectric Point (pI)

50.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012103)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G11330 AT5G11330
fragaria_vesca FvH4_2g29790 FvH4_2g29790
malus_domestica MD08G1141800.v1.1 MD15G1118300.v1.1 MD15G1335000.v1.1
prunus_persica Prupe.1G471700_v2.0.a1
pyrus_communis pycom15g10650
rosa_chinensis RchiOBHm_Chr6g0298811
rosa_laevigata RLG00000011483
rosa_multiflora Rmu_co8348659.1_g000001
rosa_roxburghii Rroxscaffold_7G00169310
rosa_rugosa Rorug06G0283000
rosa_samantha Rh6AG394700 Rh6BG402600 Rh6CG408300 Rh6DG395100
rosa_wichuraiana Rw6G034530

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 182, 208, 698
AclWI GGATC 4 cut(s) 307, 320, 481, 872
AcsI RAATTY 1 cut(s) 292
AcuI CTGAAG 2 cut(s) 467, 737
AdeI CACNNNGTG 1 cut(s) 379
AfaI GTAC 1 cut(s) 350
AfiI CCNNNNNNNGG 3 cut(s) 309, 335, 871
AflIII ACRYGT 1 cut(s) 678
AgsI TTSAA 6 cut(s) 119, 140, 158, 459, 755, 902
AhdI GACNNNNNGTC 1 cut(s) 853
AjiI CACGTC 1 cut(s) 484
AjnI CCWGG 1 cut(s) 489
AluBI AGCT 6 cut(s) 216, 235, 391, 641, 749, 898
AluI AGCT 6 cut(s) 216, 235, 391, 641, 749, 898
Alw26I GTCTC 1 cut(s) 200
AlwI GGATC 4 cut(s) 307, 320, 481, 872
AlwNI CAGNNNCTG 2 cut(s) 440, 715
Ama87I CYCGRG 1 cut(s) 335
AoxI GGCC 1 cut(s) 706
ApeKI GCWGC 4 cut(s) 5, 477, 638, 695
ApoI RAATTY 1 cut(s) 292
AsuHPI GGTGA 2 cut(s) 65, 635
AvaI CYCGRG 1 cut(s) 335
BamHI GGATCC 1 cut(s) 312
BbvCI CCTCAGC 1 cut(s) 236
BbvI GCAGC 4 cut(s) 17, 489, 650, 682
BccI CCATC 2 cut(s) 182, 435
BciT130I CCWGG 1 cut(s) 491
BclI TGATCA 1 cut(s) 226
BcoDI GTCTC 1 cut(s) 200
BfaI CTAG 1 cut(s) 99
BisI GCNGC 5 cut(s) 6, 183, 478, 639, 696
BlsI GCNGC 5 cut(s) 7, 184, 479, 640, 697
Bme1390I CCNGG 1 cut(s) 491
BmeRI GACNNNNNGTC 1 cut(s) 853
BmeT110I CYCGRG 1 cut(s) 335
BmgBI CACGTC 1 cut(s) 484
BmiI GGNNCC 1 cut(s) 314
BmrFI CCNGG 1 cut(s) 491
BmsI GCATC 2 cut(s) 625, 682
Bpu10I CCTNAGC 2 cut(s) 236, 358
BsaJI CCNNGG 1 cut(s) 594
Bsc4I CCNNNNNNNGG 3 cut(s) 309, 335, 871
Bse1I ACTGG 2 cut(s) 709, 779
Bse3DI GCAATG 1 cut(s) 501
BseBI CCWGG 1 cut(s) 491
BseDI CCNNGG 1 cut(s) 594
BseGI GGATG 1 cut(s) 697
BseLI CCNNNNNNNGG 3 cut(s) 309, 335, 871
BseMI GCAATG 1 cut(s) 501
BseMII CTCAG 2 cut(s) 227, 519
BseNI ACTGG 2 cut(s) 709, 779
BseRI GAGGAG 2 cut(s) 645, 899
BseXI GCAGC 4 cut(s) 17, 489, 650, 682
BsgI GTGCAG 1 cut(s) 750
BshFI GGCC 1 cut(s) 708
BsiHKCI CYCGRG 1 cut(s) 335
BslFI GGGAC 2 cut(s) 382, 626
BslI CCNNNNNNNGG 3 cut(s) 309, 335, 871
BsmAI GTCTC 1 cut(s) 200
BsmFI GGGAC 2 cut(s) 382, 626
BsnI GGCC 1 cut(s) 708
BsoBI CYCGRG 1 cut(s) 335
Bsp143I GATC 7 cut(s) 110, 150, 226, 312, 442, 486, 877
BspACI CCGC 3 cut(s) 182, 208, 698
BspANI GGCC 1 cut(s) 708
BspCNI CTCAG 2 cut(s) 228, 520
BspLI GGNNCC 1 cut(s) 314
BspPI GGATC 4 cut(s) 307, 320, 481, 872
BsrDI GCAATG 1 cut(s) 501
BsrI ACTGG 2 cut(s) 709, 779
BssECI CCNNGG 1 cut(s) 594
BssMI GATC 7 cut(s) 110, 150, 226, 312, 442, 486, 877
BssT1I CCWWGG 1 cut(s) 594
Bst2UI CCWGG 1 cut(s) 491
Bst4CI ACNGT 3 cut(s) 379, 587, 855
BstC8I GCNNGC 1 cut(s) 475
BstDEI CTNAG 3 cut(s) 236, 358, 528
BstEII GGTNACC 2 cut(s) 71, 774
BstF5I GGATG 1 cut(s) 697
BstKTI GATC 7 cut(s) 113, 153, 229, 315, 445, 489, 880
BstMAI GTCTC 1 cut(s) 200
BstMBI GATC 7 cut(s) 110, 150, 226, 312, 442, 486, 877
BstMWI GCNNNNNNNGC 2 cut(s) 14, 388
BstNI CCWGG 1 cut(s) 491
BstNSI RCATGY 2 cut(s) 29, 682
BstPI GGTNACC 2 cut(s) 71, 774
BstSCI CCNGG 1 cut(s) 489
BstV1I GCAGC 4 cut(s) 17, 489, 650, 682
BstX2I RGATCY 1 cut(s) 312
BstYI RGATCY 1 cut(s) 312
BsuRI GGCC 1 cut(s) 708
BtrI CACGTC 1 cut(s) 484
BtsCI GGATG 1 cut(s) 697
BtsIMutI CAGTG 3 cut(s) 375, 592, 716
Cac8I GCNNGC 1 cut(s) 475
CaiI CAGNNNCTG 2 cut(s) 440, 715
Csp6I GTAC 1 cut(s) 349
CspCI CAANNNNNGTGG 2 cut(s) 39, 74
CviAII CATG 7 cut(s) 26, 41, 258, 659, 679, 803, 913
CviQI GTAC 1 cut(s) 349
DdeI CTNAG 3 cut(s) 236, 358, 528
DpnI GATC 7 cut(s) 112, 152, 228, 314, 444, 488, 879
DpnII GATC 7 cut(s) 110, 150, 226, 312, 442, 486, 877
DraIII CACNNNGTG 1 cut(s) 379
DriI GACNNNNNGTC 1 cut(s) 853
Eam1105I GACNNNNNGTC 1 cut(s) 853
EciI GGCGGA 1 cut(s) 197
Eco130I CCWWGG 1 cut(s) 594
Eco57I CTGAAG 2 cut(s) 467, 737
Eco88I CYCGRG 1 cut(s) 335
Eco91I GGTNACC 2 cut(s) 71, 774
EcoO65I GGTNACC 2 cut(s) 71, 774
EcoRI GAATTC 1 cut(s) 292
EcoRII CCWGG 1 cut(s) 489
EcoT14I CCWWGG 1 cut(s) 594
ErhI CCWWGG 1 cut(s) 594
FaeI CATG 7 cut(s) 29, 44, 261, 662, 682, 806, 916
FaqI GGGAC 2 cut(s) 382, 626
FatI CATG 7 cut(s) 25, 40, 257, 658, 678, 802, 912
FbaI TGATCA 1 cut(s) 226
Fnu4HI GCNGC 5 cut(s) 6, 183, 478, 639, 696
FokI GGATG 1 cut(s) 704
Fsp4HI GCNGC 5 cut(s) 6, 183, 478, 639, 696
FspBI CTAG 1 cut(s) 99
GluI GCNGC 5 cut(s) 6, 183, 478, 639, 696
HaeIII GGCC 1 cut(s) 708
Hin1II CATG 7 cut(s) 29, 44, 261, 662, 682, 806, 916
HindIII AAGCTT 1 cut(s) 214
HinfI GANTC 1 cut(s) 370
HphI GGTGA 2 cut(s) 65, 635
Hpy166II GTNNAC 1 cut(s) 590
Hpy188I TCNGA 5 cut(s) 298, 317, 396, 447, 928
Hpy188III TCNNGA 7 cut(s) 272, 282, 337, 527, 752, 845, 881
Hpy8I GTNNAC 1 cut(s) 590
Hpy99I CGWCG 1 cut(s) 485
HpyAV CCTTC 6 cut(s) 118, 146, 442, 463, 809, 865
HpyCH4III ACNGT 3 cut(s) 379, 587, 855
HpyCH4IV ACGT 2 cut(s) 483, 930
HpyCH4V TGCA 7 cut(s) 257, 499, 638, 662, 731, 742, 806
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 388
HpyF3I CTNAG 3 cut(s) 236, 358, 528
HpySE526I ACGT 2 cut(s) 483, 930
Hsp92II CATG 7 cut(s) 29, 44, 261, 662, 682, 806, 916
Ksp22I TGATCA 1 cut(s) 226
Kzo9I GATC 7 cut(s) 110, 150, 226, 312, 442, 486, 877
LmnI GCTCC 1 cut(s) 598
Lsp1109I GCAGC 4 cut(s) 17, 489, 650, 682
LweI GCATC 2 cut(s) 625, 682
MaeI CTAG 1 cut(s) 99
MaeII ACGT 2 cut(s) 483, 930
MaeIII GTNAC 4 cut(s) 71, 101, 143, 774
MalI GATC 7 cut(s) 112, 152, 228, 314, 444, 488, 879
MboI GATC 7 cut(s) 110, 150, 226, 312, 442, 486, 877
MboII GAAGA 4 cut(s) 526, 730, 767, 833
MflI RGATCY 1 cut(s) 312
MluCI AATT 3 cut(s) 292, 409, 454
MlyI GAGTC 1 cut(s) 364
MmeI TCCRAC 1 cut(s) 610
MnlI CCTC 5 cut(s) 231, 257, 666, 813, 877
MseI TTAA 1 cut(s) 825
MslI CAYNNNNRTG 1 cut(s) 677
MspR9I CCNGG 1 cut(s) 491
MvaI CCWGG 1 cut(s) 491
MwoI GCNNNNNNNGC 2 cut(s) 14, 388
NdeII GATC 7 cut(s) 110, 150, 226, 312, 442, 486, 877
NlaIII CATG 7 cut(s) 29, 44, 261, 662, 682, 806, 916
NlaIV GGNNCC 1 cut(s) 314
NmuCI GTSAC 2 cut(s) 71, 101
NspI RCATGY 2 cut(s) 29, 682
PciI ACATGT 1 cut(s) 678
PkrI GCNGC 5 cut(s) 7, 184, 479, 640, 697
PleI GAGTC 1 cut(s) 364
PpsI GAGTC 1 cut(s) 364
PscI ACATGT 1 cut(s) 678
Psp6I CCWGG 1 cut(s) 489
PspEI GGTNACC 2 cut(s) 71, 774
PspGI CCWGG 1 cut(s) 489
PspN4I GGNNCC 1 cut(s) 314
PstNI CAGNNNCTG 2 cut(s) 440, 715
PsuI RGATCY 1 cut(s) 312
RsaI GTAC 1 cut(s) 350
RsaNI GTAC 1 cut(s) 349
RseI CAYNNNNRTG 1 cut(s) 677
SaqAI TTAA 1 cut(s) 825
SatI GCNGC 5 cut(s) 6, 183, 478, 639, 696
Sau3AI GATC 7 cut(s) 110, 150, 226, 312, 442, 486, 877
SchI GAGTC 1 cut(s) 364
ScrFI CCNGG 1 cut(s) 491
SfaNI GCATC 2 cut(s) 625, 682
SmiMI CAYNNNNRTG 1 cut(s) 677
Sse9I AATT 3 cut(s) 292, 409, 454
SsiI CCGC 3 cut(s) 182, 208, 698
SspMI CTAG 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 489
StyI CCWWGG 1 cut(s) 594
TaaI ACNGT 3 cut(s) 379, 587, 855
TaiI ACGT 2 cut(s) 486, 933
TaqI TCGA 1 cut(s) 788
TaqII GACCGA 2 cut(s) 673, 864
TasI AATT 3 cut(s) 292, 409, 454
TatI WGTACW 1 cut(s) 348
TauI GCSGC 1 cut(s) 185
Tru1I TTAA 1 cut(s) 825
Tru9I TTAA 1 cut(s) 825
TscAI CASTG 3 cut(s) 382, 592, 716
TseFI GTSAC 2 cut(s) 71, 101
TseI GCWGC 4 cut(s) 5, 477, 638, 695
Tsp45I GTSAC 2 cut(s) 71, 101
TspDTI ATGAA 2 cut(s) 556, 791
TspRI CASTG 3 cut(s) 382, 592, 716
XapI RAATTY 1 cut(s) 292
XceI RCATGY 2 cut(s) 29, 682
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.