Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8353983.1

Orthogroup ID

OG0017162

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 941

Gene Structure 940 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8353983.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 940 bp

atgtattgtaggatgcaggagaccggtgtgagtccagatggctttactttccctcatgtgctcaaagcttgcggtggcttggccgcgcttgaaatgggccgccgggttcactgccaggcgtttcgacatgggtttgagtcggatgtgtttgtgcagaacagtctcgtggcgttttatgccaaatgtggtagagtagaacgcgctaggattgtgtttgatgggttgggtgagaggtcggttgtttcgtggacttcgatcatttcagggtatgcgcagaatggccagtgtttggaagctctgagagtttttagtgtgatgagagagttgaatgttagaccggattggattgttttggttagtgttctcaaagcgtatactgatgtagaggacttgggacaggggaggtctgttcatggatgtttagttaaaatgggacttgactttgaacctgacttggtcatttcactcacagccatgtatgctaaaagtgggcaggtgatggttgccagatcattttttgataagatggaaagaccaaatgtaatgatgtggaatgctatgatttccggctatgcaaagaacggtcatgctgagaaagctgtagagctattccgtgagatgatctctagaagcattagaattgattcaattactctgaggtctgctatctcagcatgcgcccaggtcggttctcttgaactagcgaaatggatggatgattatatcagcaaaagtgagtatagaaatcatgtttttgttaacacagccctaattgatatgtatgcaaaatgtggtagtgtatattttgctcgcttggtctttgatagaacacctaataaagatgttgtcgtctggagtgcaatgattgtgggctatggattgcatggtcgaggacaagaagccattgatgtttactattctatgcagcaggctggggtgg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000959 GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016071 GO:0016556 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0046483 GO:0071704 GO:0080156 GO:0090304 GO:0090305 GO:0097159 GO:1900864 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase HLH PPR PPR_2

Protein Analysis

313

Amino Acids

35.05

Weight (kDa)

8.07

Isoelectric Point (pI)

36.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017162)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G12770
fragaria_vesca	FvH4_6g08230
malus_domestica	MD09G1101900.v1.1
prunus_persica	Prupe.3G223800_v2.0.a1
pyrus_communis	pycom09g02560
rosa_chinensis	RchiOBHm_Chr3g0458151
rosa_multiflora	Rmu_co8353983.1_g000001
rosa_roxburghii	Rroxscaffold_6G00421260
rosa_rugosa	Rorug03G0025100
rosa_samantha	Rh3AG085800 Rh3BG088500 Rh3DG089500
rosa_wichuraiana	Rw3G007290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	484
Acc16I	TGCGCA	1 cut(s)	273
Acc36I	ACCTGC	1 cut(s)	484
AccB7I	CCANNNNNTGG	1 cut(s)	289
AccI	GTMKAC	1 cut(s)	374
AccII	CGCG	2 cut(s)	86, 201
AciI	CCGC	3 cut(s)	72, 84, 100
AcoI	YGGCCR	2 cut(s)	81, 280
AfiI	CCNNNNNNNGG	1 cut(s)	289
AgeI	ACCGGT	1 cut(s)	23
AgsI	TTSAA	5 cut(s)	92, 328, 446, 648, 698
AjnI	CCWGG	2 cut(s)	114, 681
AluBI	AGCT	4 cut(s)	68, 296, 599, 607
AluI	AGCT	4 cut(s)	68, 296, 599, 607
Alw21I	GWGCWC	1 cut(s)	63
Alw26I	GTCTC	2 cut(s)	14, 167
AoxI	GGCC	3 cut(s)	81, 97, 280
ApeKI	GCWGC	1 cut(s)	925
AsiGI	ACCGGT	1 cut(s)	23
Asp700I	GAANNNNTTC	1 cut(s)	643
AspLEI	GCGC	4 cut(s)	88, 203, 274, 680
AspS9I	GGNCC	1 cut(s)	97
AsuC2I	CCSGG	1 cut(s)	104
AsuHPI	GGTGA	2 cut(s)	239, 508
BalI	TGGCCA	1 cut(s)	282
BauI	CACGAG	1 cut(s)	164
Bbv12I	GWGCWC	1 cut(s)	63
BccI	CCATC	5 cut(s)	32, 212, 493, 520, 706
BciT130I	CCWGG	2 cut(s)	116, 683
BcnI	CCSGG	1 cut(s)	104
BcoDI	GTCTC	2 cut(s)	14, 167
BfaI	CTAG	3 cut(s)	204, 627, 701
BfmI	CTRYAG	1 cut(s)	600
BfuAI	ACCTGC	1 cut(s)	484
BisI	GCNGC	3 cut(s)	84, 100, 926
BlsI	GCNGC	3 cut(s)	85, 101, 927
Bme1390I	CCNGG	3 cut(s)	104, 116, 683
BmgT120I	GGNCC	1 cut(s)	97
BmrFI	CCNGG	3 cut(s)	104, 116, 683
BmsI	GCATC	1 cut(s)	3
BplI	GAGNNNNNCTC	2 cut(s)	608, 640
BpmI	CTGGAG	1 cut(s)	874
BpuMI	CCSGG	1 cut(s)	104
BsaI	GGTCTC	1 cut(s)	14
BsaJI	CCNNGG	1 cut(s)	681
BsaWI	WCCGGW	2 cut(s)	23, 337
Bsc4I	CCNNNNNNNGG	1 cut(s)	289
Bse118I	RCCGGY	1 cut(s)	23
Bse1I	ACTGG	1 cut(s)	283
Bse3DI	GCAATG	1 cut(s)	867
BseBI	CCWGG	2 cut(s)	116, 683
BseDI	CCNNGG	1 cut(s)	681
BseGI	GGATG	5 cut(s)	18, 148, 422, 717, 721
BseLI	CCNNNNNNNGG	1 cut(s)	289
BseMI	GCAATG	1 cut(s)	867
BseMII	CTCAG	4 cut(s)	290, 582, 647, 684
BseNI	ACTGG	1 cut(s)	283
BseYI	CCCAGC	1 cut(s)	932
BsgI	GTGCAG	1 cut(s)	173
Bsh1236I	CGCG	2 cut(s)	86, 201
BshFI	GGCC	3 cut(s)	83, 99, 282
BshTI	ACCGGT	1 cut(s)	23
BsiHKAI	GWGCWC	1 cut(s)	63
BsiSI	CCGG	4 cut(s)	24, 103, 338, 567
BslFI	GGGAC	2 cut(s)	408, 447
BslI	CCNNNNNNNGG	1 cut(s)	289
BsmAI	GTCTC	2 cut(s)	14, 167
BsmFI	GGGAC	2 cut(s)	408, 447
BsmI	GAATGC	1 cut(s)	559
BsnI	GGCC	3 cut(s)	83, 99, 282
Bso31I	GGTCTC	1 cut(s)	14
Bsp1286I	GDGCHC	1 cut(s)	63
Bsp143I	GATC	3 cut(s)	255, 509, 621
BspACI	CCGC	3 cut(s)	72, 84, 100
BspANI	GGCC	3 cut(s)	83, 99, 282
BspCNI	CTCAG	4 cut(s)	291, 583, 648, 683
BspFNI	CGCG	2 cut(s)	86, 201
BspMI	ACCTGC	1 cut(s)	484
BspTNI	GGTCTC	1 cut(s)	14
BsrDI	GCAATG	1 cut(s)	867
BsrFI	RCCGGY	1 cut(s)	23
BsrI	ACTGG	1 cut(s)	283
BssAI	RCCGGY	1 cut(s)	23
BssECI	CCNNGG	1 cut(s)	681
BssMI	GATC	3 cut(s)	255, 509, 621
BssNAI	GTATAC	1 cut(s)	375
BssSI	CACGAG	1 cut(s)	164
Bst1107I	GTATAC	1 cut(s)	375
Bst2BI	CACGAG	1 cut(s)	164
Bst2UI	CCWGG	2 cut(s)	116, 683
Bst4CI	ACNGT	2 cut(s)	161, 584
BstC8I	GCNNGC	4 cut(s)	70, 676, 811, 930
BstDEI	CTNAG	4 cut(s)	299, 591, 656, 670
BstF5I	GGATG	5 cut(s)	18, 148, 422, 717, 721
BstFNI	CGCG	2 cut(s)	86, 201
BstHHI	GCGC	4 cut(s)	88, 203, 274, 680
BstKTI	GATC	3 cut(s)	258, 512, 624
BstMAI	GTCTC	2 cut(s)	14, 167
BstMBI	GATC	3 cut(s)	255, 509, 621
BstMWI	GCNNNNNNNGC	4 cut(s)	176, 479, 596, 671
BstNI	CCWGG	2 cut(s)	116, 683
BstNSI	RCATGY	1 cut(s)	678
BstSCI	CCNGG	3 cut(s)	102, 114, 681
BstSFI	CTRYAG	1 cut(s)	600
BstUI	CGCG	2 cut(s)	86, 201
BstZ17I	GTATAC	1 cut(s)	375
BsuRI	GGCC	3 cut(s)	83, 99, 282
BtsCI	GGATG	5 cut(s)	18, 148, 422, 717, 721
BtsI	GCAGTG	1 cut(s)	109
BtsIMutI	CAGTG	2 cut(s)	109, 290
BveI	ACCTGC	1 cut(s)	484
Cac8I	GCNNGC	4 cut(s)	70, 676, 811, 930
CfoI	GCGC	4 cut(s)	88, 203, 274, 680
Cfr10I	RCCGGY	1 cut(s)	23
Cfr13I	GGNCC	1 cut(s)	97
CspAI	ACCGGT	1 cut(s)	23
CspCI	CAANNNNNGTGG	2 cut(s)	849, 884
CviAII	CATG	8 cut(s)	56, 128, 413, 475, 587, 675, 749, 884
DdeI	CTNAG	4 cut(s)	299, 591, 656, 670
DpnI	GATC	3 cut(s)	257, 511, 623
DpnII	GATC	3 cut(s)	255, 509, 621
EaeI	YGGCCR	2 cut(s)	81, 280
Eco31I	GGTCTC	1 cut(s)	14
EcoRII	CCWGG	2 cut(s)	114, 681
FaeI	CATG	8 cut(s)	59, 131, 416, 478, 590, 678, 752, 887
FaqI	GGGAC	2 cut(s)	408, 447
FatI	CATG	8 cut(s)	55, 127, 412, 474, 586, 674, 748, 883
FblI	GTMKAC	1 cut(s)	374
Fnu4HI	GCNGC	3 cut(s)	84, 100, 926
FokI	GGATG	5 cut(s)	25, 155, 429, 724, 728
Fsp4HI	GCNGC	3 cut(s)	84, 100, 926
FspBI	CTAG	3 cut(s)	204, 627, 701
FspI	TGCGCA	1 cut(s)	273
GlaI	GCGC	4 cut(s)	87, 202, 273, 679
GluI	GCNGC	3 cut(s)	84, 100, 926
GsaI	CCCAGC	1 cut(s)	936
GsuI	CTGGAG	1 cut(s)	874
HaeIII	GGCC	3 cut(s)	83, 99, 282
HapII	CCGG	4 cut(s)	24, 103, 338, 567
HhaI	GCGC	4 cut(s)	88, 203, 274, 680
Hin1II	CATG	8 cut(s)	59, 131, 416, 478, 590, 678, 752, 887
Hin6I	GCGC	4 cut(s)	86, 201, 272, 678
HinP1I	GCGC	4 cut(s)	86, 201, 272, 678
HincII	GTYRAC	1 cut(s)	760
HindII	GTYRAC	1 cut(s)	760
HindIII	AAGCTT	1 cut(s)	66
HinfI	GANTC	3 cut(s)	31, 137, 644
HpaI	GTTAAC	1 cut(s)	760
HpaII	CCGG	4 cut(s)	24, 103, 338, 567
HphI	GGTGA	2 cut(s)	239, 508
Hpy166II	GTNNAC	5 cut(s)	109, 249, 375, 760, 913
Hpy188I	TCNGA	3 cut(s)	142, 300, 657
Hpy188III	TCNNGA	4 cut(s)	35, 627, 695, 853
Hpy8I	GTNNAC	5 cut(s)	109, 249, 375, 760, 913
HpyCH4III	ACNGT	2 cut(s)	161, 584
HpyCH4V	TGCA	7 cut(s)	16, 154, 575, 785, 860, 883, 925
HpyF10VI	GCNNNNNNNGC	4 cut(s)	176, 479, 596, 671
HpyF3I	CTNAG	4 cut(s)	299, 591, 656, 670
Hsp92II	CATG	8 cut(s)	59, 131, 416, 478, 590, 678, 752, 887
HspAI	GCGC	4 cut(s)	86, 201, 272, 678
KspAI	GTTAAC	1 cut(s)	760
Kzo9I	GATC	3 cut(s)	255, 509, 621
LweI	GCATC	1 cut(s)	3
MaeI	CTAG	3 cut(s)	204, 627, 701
MalI	GATC	3 cut(s)	257, 511, 623
MboI	GATC	3 cut(s)	255, 509, 621
MhlI	GDGCHC	1 cut(s)	63
MlsI	TGGCCA	1 cut(s)	282
MluCI	AATT	3 cut(s)	639, 648, 771
MluNI	TGGCCA	1 cut(s)	282
MlyI	GAGTC	2 cut(s)	40, 146
MmeI	TCCRAC	1 cut(s)	120
MnlI	CCTC	6 cut(s)	63, 225, 379, 396, 651, 884
Mox20I	TGGCCA	1 cut(s)	282
MroXI	GAANNNNTTC	1 cut(s)	643
MscI	TGGCCA	1 cut(s)	282
MseI	TTAA	2 cut(s)	426, 759
MslI	CAYNNNNRTG	1 cut(s)	473
Msp20I	TGGCCA	1 cut(s)	282
MspI	CCGG	4 cut(s)	24, 103, 338, 567
MspR9I	CCNGG	3 cut(s)	104, 116, 683
Mva1269I	GAATGC	1 cut(s)	559
MvaI	CCWGG	2 cut(s)	116, 683
MvnI	CGCG	2 cut(s)	86, 201
MwoI	GCNNNNNNNGC	4 cut(s)	176, 479, 596, 671
NciI	CCSGG	1 cut(s)	104
NdeII	GATC	3 cut(s)	255, 509, 621
NlaIII	CATG	8 cut(s)	59, 131, 416, 478, 590, 678, 752, 887
NsbI	TGCGCA	1 cut(s)	273
NspI	RCATGY	1 cut(s)	678
PaeI	GCATGC	1 cut(s)	678
PaqCI	CACCTGC	1 cut(s)	484
PcsI	WCGNNNNNNNCGW	2 cut(s)	242, 251
PctI	GAATGC	1 cut(s)	559
PdmI	GAANNNNTTC	1 cut(s)	643
PfeI	GAWTC	1 cut(s)	644
PflFI	GACNNNGTC	1 cut(s)	455
PflMI	CCANNNNNTGG	1 cut(s)	289
PinAI	ACCGGT	1 cut(s)	23
PkrI	GCNGC	3 cut(s)	85, 101, 927
PleI	GAGTC	2 cut(s)	39, 145
PpsI	GAGTC	2 cut(s)	39, 145
Psp6I	CCWGG	2 cut(s)	114, 681
PspFI	CCCAGC	1 cut(s)	932
PspGI	CCWGG	2 cut(s)	114, 681
PspPI	GGNCC	1 cut(s)	97
PsyI	GACNNNGTC	1 cut(s)	455
RseI	CAYNNNNRTG	1 cut(s)	473
SaqAI	TTAA	2 cut(s)	426, 759
SatI	GCNGC	3 cut(s)	84, 100, 926
Sau3AI	GATC	3 cut(s)	255, 509, 621
Sau96I	GGNCC	1 cut(s)	97
SchI	GAGTC	2 cut(s)	40, 146
ScrFI	CCNGG	3 cut(s)	104, 116, 683
SduI	GDGCHC	1 cut(s)	63
SfaNI	GCATC	1 cut(s)	3
SfcI	CTRYAG	1 cut(s)	600
SmiMI	CAYNNNNRTG	1 cut(s)	473
SphI	GCATGC	1 cut(s)	678
Sse9I	AATT	3 cut(s)	639, 648, 771
SsiI	CCGC	3 cut(s)	72, 84, 100
SspMI	CTAG	3 cut(s)	204, 627, 701
StyD4I	CCNGG	3 cut(s)	102, 114, 681
TaaI	ACNGT	2 cut(s)	161, 584
TaqI	TCGA	3 cut(s)	124, 254, 889
TasI	AATT	3 cut(s)	639, 648, 771
TauI	GCSGC	2 cut(s)	86, 102
TfiI	GAWTC	1 cut(s)	644
Tru1I	TTAA	2 cut(s)	426, 759
Tru9I	TTAA	2 cut(s)	426, 759
TscAI	CASTG	2 cut(s)	116, 290
TseI	GCWGC	1 cut(s)	925
TspDTI	ATGAA	1 cut(s)	401
TspGWI	ACGGA	1 cut(s)	602
TspRI	CASTG	2 cut(s)	116, 290
Tth111I	GACNNNGTC	1 cut(s)	455
Van91I	CCANNNNNTGG	1 cut(s)	289
XbaI	TCTAGA	1 cut(s)	626
XceI	RCATGY	1 cut(s)	678
XmiI	GTMKAC	1 cut(s)	374
XmnI	GAANNNNTTC	1 cut(s)	643
XspI	CTAG	3 cut(s)	204, 627, 701

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.