Rmu_co8359799.1_g000001

nuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8359799.1
OG0015047
Physical Location & Seq
Reverse (-)
759 .. 1058
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8359799.1_g000001.1.cds

Sequence Viewer

Length: 300 bp
atgctcatgaaggggagatctgtggtggttgaggcaattgggctgctcaaagggaggtggaagattctgcaggacctgaatgtgggtcttaatcatgtgccgcagaccattgttgcttgctgtgtgctgcacaatttgtgccagattgcgagggagcctgaaccggagctgtggaaggaccctgaggagaatgggatgcctcctagggtgcatgacagtgagaagtcgttgtactactttggggaaagcttgaggcaagcattggctgatgatttgcaccagaggctttcatcgagatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DDE_Tnp_4

Protein Analysis

99

Amino Acids

11.29

Weight (kDa)

6.4

Isoelectric Point (pI)

63.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015047)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G19120
fragaria_vesca FvH4_2g06711
prunus_persica Prupe.8G119100_v2.0.a1
pyrus_communis pycom05g06910
rosa_chinensis RchiOBHm_Chr6g0258821
rosa_laevigata RLG00000014583
rosa_multiflora Rmu_co8359799.1_g000001 Rmu_sc0004485.1_g000014
rosa_roxburghii Rroxscaffold_7G00206090
rosa_rugosa Rorug05G0583500 Rorug05G0583600
rosa_samantha Rh6AG100100 Rh6BG091600 Rh6CG089100 Rh6DG083400
rosa_wichuraiana Rw6G008660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 101
AfaI GTAC 1 cut(s) 233
AfiI CCNNNNNNNGG 1 cut(s) 82
AluBI AGCT 2 cut(s) 169, 249
AluI AGCT 2 cut(s) 169, 249
AlwNI CAGNNNCTG 1 cut(s) 76
ApeKI GCWGC 2 cut(s) 43, 127
AspA2I CCTAGG 1 cut(s) 203
AspS9I GGNCC 2 cut(s) 73, 178
AvaII GGWCC 2 cut(s) 73, 178
AvrII CCTAGG 1 cut(s) 203
AxyI CCTNAGG 1 cut(s) 183
BarI GAAGNNNNNNTAC 2 cut(s) 215, 247
BbvI GCAGC 2 cut(s) 30, 114
BfaI CTAG 1 cut(s) 204
BfmI CTRYAG 1 cut(s) 68
BglII AGATCT 1 cut(s) 17
BisI GCNGC 3 cut(s) 44, 101, 128
BlnI CCTAGG 1 cut(s) 203
BlsI GCNGC 3 cut(s) 45, 102, 129
Bme18I GGWCC 2 cut(s) 73, 178
BmgT120I GGNCC 2 cut(s) 73, 178
BmiI GGNNCC 2 cut(s) 156, 180
BmsI GCATC 1 cut(s) 186
BpuEI CTTGAG 1 cut(s) 271
BsaJI CCNNGG 1 cut(s) 203
BsaWI WCCGGW 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 82
Bse21I CCTNAGG 1 cut(s) 183
BseDI CCNNGG 1 cut(s) 203
BseGI GGATG 1 cut(s) 201
BseLI CCNNNNNNNGG 1 cut(s) 82
BseMII CTCAG 1 cut(s) 174
BseRI GAGGAG 1 cut(s) 200
BseXI GCAGC 2 cut(s) 30, 114
BsgI GTGCAG 1 cut(s) 113
BsiSI CCGG 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 82
Bsp143I GATC 1 cut(s) 17
BspACI CCGC 1 cut(s) 101
BspCNI CTCAG 1 cut(s) 175
BspHI TCATGA 1 cut(s) 6
BspLI GGNNCC 2 cut(s) 156, 180
BspMAI CTGCAG 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 203
BssMI GATC 1 cut(s) 17
BssT1I CCWWGG 1 cut(s) 203
Bst4CI ACNGT 1 cut(s) 218
BstC8I GCNNGC 2 cut(s) 118, 258
BstDEI CTNAG 1 cut(s) 183
BstF5I GGATG 1 cut(s) 201
BstKTI GATC 1 cut(s) 20
BstMBI GATC 1 cut(s) 17
BstMWI GCNNNNNNNGC 1 cut(s) 283
BstSFI CTRYAG 1 cut(s) 68
BstV1I GCAGC 2 cut(s) 30, 114
BstX2I RGATCY 1 cut(s) 17
BstYI RGATCY 1 cut(s) 17
Bsu36I CCTNAGG 1 cut(s) 183
BtsCI GGATG 1 cut(s) 201
BtsIMutI CAGTG 1 cut(s) 223
Cac8I GCNNGC 2 cut(s) 118, 258
CaiI CAGNNNCTG 1 cut(s) 76
CciI TCATGA 1 cut(s) 6
Cfr13I GGNCC 2 cut(s) 73, 178
Csp6I GTAC 1 cut(s) 232
CviAII CATG 3 cut(s) 7, 95, 212
CviJI RGCY 6 cut(s) 43, 157, 169, 249, 266, 286
CviKI_1 RGCY 6 cut(s) 43, 157, 169, 249, 266, 286
CviQI GTAC 1 cut(s) 232
DdeI CTNAG 1 cut(s) 183
DpnI GATC 1 cut(s) 19
DpnII GATC 1 cut(s) 17
Eco130I CCWWGG 1 cut(s) 203
Eco47I GGWCC 2 cut(s) 73, 178
Eco81I CCTNAGG 1 cut(s) 183
EcoO109I RGGNCCY 2 cut(s) 73, 178
EcoT14I CCWWGG 1 cut(s) 203
ErhI CCWWGG 1 cut(s) 203
FaeI CATG 3 cut(s) 10, 98, 215
FaiI YATR 3 cut(s) 8, 96, 213
FatI CATG 3 cut(s) 6, 94, 211
Fnu4HI GCNGC 3 cut(s) 44, 101, 128
FokI GGATG 1 cut(s) 208
Fsp4HI GCNGC 3 cut(s) 44, 101, 128
FspBI CTAG 1 cut(s) 204
GluI GCNGC 3 cut(s) 44, 101, 128
HapII CCGG 1 cut(s) 164
Hin1II CATG 3 cut(s) 10, 98, 215
HindIII AAGCTT 1 cut(s) 247
HinfI GANTC 1 cut(s) 64
HpaII CCGG 1 cut(s) 164
Hpy188III TCNNGA 2 cut(s) 7, 294
HpyAV CCTTC 2 cut(s) 4, 169
HpyCH4III ACNGT 1 cut(s) 218
HpyCH4V TGCA 4 cut(s) 70, 130, 211, 277
HpyF10VI GCNNNNNNNGC 1 cut(s) 283
HpyF3I CTNAG 1 cut(s) 183
Hsp92II CATG 3 cut(s) 10, 98, 215
Kzo9I GATC 1 cut(s) 17
LmnI GCTCC 2 cut(s) 154, 166
LpnPI CCDG 7 cut(s) 56, 89, 155, 171, 177, 195, 293
Lsp1109I GCAGC 2 cut(s) 30, 114
LweI GCATC 1 cut(s) 186
MaeI CTAG 1 cut(s) 204
MalI GATC 1 cut(s) 19
MboI GATC 1 cut(s) 17
MboII GAAGA 1 cut(s) 73
MfeI CAATTG 1 cut(s) 36
MflI RGATCY 1 cut(s) 17
MluCI AATT 2 cut(s) 36, 133
MnlI CCTC 7 cut(s) 25, 48, 144, 178, 210, 246, 276
MseI TTAA 1 cut(s) 90
MslI CAYNNNNRTG 1 cut(s) 216
MspI CCGG 1 cut(s) 164
MunI CAATTG 1 cut(s) 36
MwoI GCNNNNNNNGC 1 cut(s) 283
NdeII GATC 1 cut(s) 17
NlaIII CATG 3 cut(s) 10, 98, 215
NlaIV GGNNCC 2 cut(s) 156, 180
PagI TCATGA 1 cut(s) 6
PfeI GAWTC 1 cut(s) 64
PkrI GCNGC 3 cut(s) 45, 102, 129
PpuMI RGGWCCY 2 cut(s) 73, 178
Psp5II RGGWCCY 2 cut(s) 73, 178
PspN4I GGNNCC 2 cut(s) 156, 180
PspPI GGNCC 2 cut(s) 73, 178
PspPPI RGGWCCY 2 cut(s) 73, 178
PstI CTGCAG 1 cut(s) 72
PstNI CAGNNNCTG 1 cut(s) 76
PsuI RGATCY 1 cut(s) 17
RsaI GTAC 1 cut(s) 233
RsaNI GTAC 1 cut(s) 232
RseI CAYNNNNRTG 1 cut(s) 216
SaqAI TTAA 1 cut(s) 90
SatI GCNGC 3 cut(s) 44, 101, 128
Sau3AI GATC 1 cut(s) 17
Sau96I GGNCC 2 cut(s) 73, 178
SetI ASST 4 cut(s) 59, 78, 171, 251
SfaNI GCATC 1 cut(s) 186
SfcI CTRYAG 1 cut(s) 68
SinI GGWCC 2 cut(s) 73, 178
SmiMI CAYNNNNRTG 1 cut(s) 216
SmlI CTYRAG 1 cut(s) 250
SmoI CTYRAG 1 cut(s) 250
Sse9I AATT 2 cut(s) 36, 133
SsiI CCGC 1 cut(s) 101
SspMI CTAG 1 cut(s) 204
StyI CCWWGG 1 cut(s) 203
TaaI ACNGT 1 cut(s) 218
TaqI TCGA 1 cut(s) 293
TasI AATT 2 cut(s) 36, 133
TatI WGTACW 1 cut(s) 231
TauI GCSGC 1 cut(s) 103
TfiI GAWTC 1 cut(s) 64
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 223
TseI GCWGC 2 cut(s) 43, 127
TspDTI ATGAA 2 cut(s) 23, 279
TspRI CASTG 1 cut(s) 223
VpaK11BI GGWCC 2 cut(s) 73, 178
XmaJI CCTAGG 1 cut(s) 203
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.