Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8369127.1

Orthogroup ID

OG0006703

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 406

Gene Structure 406 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8369127.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 332 bp

aatctctccttcaactaggtggttcctcgggggataattattcatctacttgtcaagctctacaatttcccacagaggaaatatcttcccagcttcttacttgtgatgatatgaacatcagatgcctgaatgactcacctcataaaagaactcttactcatttcatcaaagataatgtcaacgtccacgacagctcagccctttgcctccagatatcgctcgacagacagaaggctcagcccttggggattgatattgacaagccaagctgggatgggagtgaaaaggagataacttttgatgatggtgatgtcaattatattcaattgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

109

Amino Acids

12.12

Weight (kDa)

4.42

Isoelectric Point (pI)

64.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006703)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G20250 AT2G20250 AT2G20250
fragaria_vesca	FvH4_2g19950
malus_domestica	MD10G1171500.v1.1 MD10G1171600.v1.1
prunus_persica	Prupe.8G209900_v2.0.a1 Prupe.8G209900_v2.0.a1 Prupe.8G209900_v2.0.a1
pyrus_communis	pycom05g16880 pycom10g14790
rosa_chinensis	RchiOBHm_Chr6g0285611
rosa_laevigata	RLG00000012622
rosa_multiflora	Rmu_co8369127.1_g000001 Rmu_sc0001356.1_g000025 Rmu_sc0015474.1_g000001 Rmu_sc0017770.1_g000010
rosa_roxburghii	Rroxscaffold_7G00182890
rosa_rugosa	Rorug06G0176200
rosa_samantha	Rh6AG287500 Rh6BG288900 Rh6CG290000 Rh6CG290100 Rh6DG282700 Rh6DG282800
rosa_wichuraiana	Rw6G024720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	2 cut(s)	13, 325
AluBI	AGCT	4 cut(s)	58, 93, 194, 269
AluI	AGCT	4 cut(s)	58, 93, 194, 269
Ama87I	CYCGRG	1 cut(s)	27
ArsI	GACNNNNNNTTYG	2 cut(s)	161, 193
AsuHPI	GGTGA	2 cut(s)	128, 319
AvaI	CYCGRG	1 cut(s)	27
BccI	CCATC	2 cut(s)	268, 298
BfaI	CTAG	1 cut(s)	16
BlpI	GCTNAGC	2 cut(s)	195, 236
BmeT110I	CYCGRG	1 cut(s)	27
BmiI	GGNNCC	1 cut(s)	24
BmsI	GCATC	1 cut(s)	112
BpmI	CTGGAG	1 cut(s)	193
Bpu1102I	GCTNAGC	2 cut(s)	195, 236
BsaJI	CCNNGG	2 cut(s)	26, 242
BseDI	CCNNGG	2 cut(s)	26, 242
BseGI	GGATG	1 cut(s)	279
BseMII	CTCAG	2 cut(s)	209, 250
BseYI	CCCAGC	2 cut(s)	89, 269
BsiHKCI	CYCGRG	1 cut(s)	27
BsoBI	CYCGRG	1 cut(s)	27
Bsp1720I	GCTNAGC	2 cut(s)	195, 236
BspCNI	CTCAG	2 cut(s)	208, 249
BspLI	GGNNCC	1 cut(s)	24
BssECI	CCNNGG	2 cut(s)	26, 242
BssT1I	CCWWGG	1 cut(s)	242
BstDEI	CTNAG	2 cut(s)	195, 236
BstF5I	GGATG	1 cut(s)	279
BtsCI	GGATG	1 cut(s)	279
CviJI	RGCY	8 cut(s)	58, 93, 194, 199, 235, 240, 264, 269
CviKI_1	RGCY	8 cut(s)	58, 93, 194, 199, 235, 240, 264, 269
DdeI	CTNAG	2 cut(s)	195, 236
Eco130I	CCWWGG	1 cut(s)	242
Eco32I	GATATC	1 cut(s)	215
Eco88I	CYCGRG	1 cut(s)	27
EcoRV	GATATC	1 cut(s)	215
EcoT14I	CCWWGG	1 cut(s)	242
ErhI	CCWWGG	1 cut(s)	242
FaiI	YATR	3 cut(s)	112, 143, 320
FokI	GGATG	1 cut(s)	286
FspBI	CTAG	1 cut(s)	16
GsaI	CCCAGC	2 cut(s)	93, 273
GsuI	CTGGAG	1 cut(s)	193
HincII	GTYRAC	1 cut(s)	180
HindII	GTYRAC	1 cut(s)	180
HinfI	GANTC	1 cut(s)	133
HphI	GGTGA	2 cut(s)	128, 319
Hpy166II	GTNNAC	2 cut(s)	180, 186
Hpy188I	TCNGA	1 cut(s)	121
Hpy188III	TCNNGA	1 cut(s)	210
Hpy8I	GTNNAC	2 cut(s)	180, 186
HpyAV	CCTTC	2 cut(s)	19, 225
HpyCH4IV	ACGT	1 cut(s)	182
HpyF3I	CTNAG	2 cut(s)	195, 236
HpySE526I	ACGT	1 cut(s)	182
LpnPI	CCDG	4 cut(s)	103, 139, 223, 255
LweI	GCATC	1 cut(s)	112
MaeI	CTAG	1 cut(s)	16
MaeII	ACGT	1 cut(s)	182
MboII	GAAGA	1 cut(s)	77
MfeI	CAATTG	1 cut(s)	325
MluCI	AATT	4 cut(s)	36, 64, 315, 325
MlyI	GAGTC	1 cut(s)	127
MnlI	CCTC	4 cut(s)	36, 69, 149, 217
MunI	CAATTG	1 cut(s)	325
NlaIV	GGNNCC	1 cut(s)	24
PleI	GAGTC	1 cut(s)	127
PpsI	GAGTC	1 cut(s)	127
PspFI	CCCAGC	2 cut(s)	89, 269
PspN4I	GGNNCC	1 cut(s)	24
SchI	GAGTC	1 cut(s)	127
SetI	ASST	7 cut(s)	21, 60, 95, 141, 185, 196, 271
SfaNI	GCATC	1 cut(s)	112
Sse9I	AATT	4 cut(s)	36, 64, 315, 325
SspMI	CTAG	1 cut(s)	16
StyI	CCWWGG	1 cut(s)	242
TaiI	ACGT	1 cut(s)	185
TaqI	TCGA	1 cut(s)	221
TasI	AATT	4 cut(s)	36, 64, 315, 325
TspDTI	ATGAA	3 cut(s)	32, 127, 153
XspI	CTAG	1 cut(s)	16

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.