Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017770.1

Orthogroup ID

OG0006703

Physical Location & Seq

Genomic Coordinates Reverse (-)

40261 .. 41181

Gene Structure 921 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017770.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 921 bp

atggtgcggaaagagctatgtgttcctatgctgggttgggattttgatagcacagatgaagaaagaaacttatctagcttatcaagatatagagctgactctgaattactgggagatactgcaatttcatgctctatgagtgatgtagattctgtgcttccatttaaagaatatggattgagggcatctagccatgccgaagagctgggtgttttctataagccaaacaaatatttcgttggaagagaaacttgcgctctgatgctaggttgggattttgacaccgcaaaagaaagaaactcatctaacctatcaagacgtacagctggacacacatctgcatgcatagccggttatcacagccatgatgacgaaagacagtgtcttgaaggcaagtatgaattacaatcagattttcaccaaattgagctccccttaaacctatcatgcataccaacccttctaaatcgagcctggggttgcattgatgacagagtatgggaaggtggcacaacgttcttttctctccaaaatgaccattggtttaggcggaagattatcaatgaggggcatccttatcctaatgcagaatctctccttcaactaggtggttcctcgggggataattattcatctacttgtcaagctctacaatttcccagagaggaaatatcttcccagcttcttacttgtgatgatatgaacatcagatgcctgaatgactcacctcataaaagaactcttactcatttcatcaaagataatgtcaacgtccacgacagctcagccctttgcctccagatatcgctcgacagacagaaggctcagcccttggggattgatattgacaagccaagctgggatgggagtgaaaaggagataacttttgatgatggtgatgtcaattatattcaattgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

306

Amino Acids

34.71

Weight (kDa)

4.9

Isoelectric Point (pI)

53.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006703)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G20250 AT2G20250 AT2G20250
fragaria_vesca	FvH4_2g19950
malus_domestica	MD10G1171500.v1.1 MD10G1171600.v1.1
prunus_persica	Prupe.8G209900_v2.0.a1 Prupe.8G209900_v2.0.a1 Prupe.8G209900_v2.0.a1
pyrus_communis	pycom05g16880 pycom10g14790
rosa_chinensis	RchiOBHm_Chr6g0285611
rosa_laevigata	RLG00000012622
rosa_multiflora	Rmu_co8369127.1_g000001 Rmu_sc0001356.1_g000025 Rmu_sc0015474.1_g000001 Rmu_sc0017770.1_g000010
rosa_roxburghii	Rroxscaffold_7G00182890
rosa_rugosa	Rorug06G0176200
rosa_samantha	Rh6AG287500 Rh6BG288900 Rh6CG290000 Rh6CG290100 Rh6DG282700 Rh6DG282800
rosa_wichuraiana	Rw6G024720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	7, 285, 550
AclI	AACGTT	1 cut(s)	515
AfaI	GTAC	1 cut(s)	322
AfiI	CCNNNNNNNGG	1 cut(s)	32
AgsI	TTSAA	3 cut(s)	389, 602, 914
AjnI	CCWGG	1 cut(s)	473
Alw21I	GWGCWC	1 cut(s)	432
Ama87I	CYCGRG	1 cut(s)	616
ArsI	GACNNNNNNTTYG	2 cut(s)	750, 782
AspLEI	GCGC	1 cut(s)	257
AsuHPI	GGTGA	3 cut(s)	410, 717, 908
AvaI	CYCGRG	1 cut(s)	616
BanII	GRGCYC	1 cut(s)	432
Bbv12I	GWGCWC	1 cut(s)	432
BccI	CCATC	2 cut(s)	857, 887
BciT130I	CCWGG	1 cut(s)	475
BfaI	CTAG	4 cut(s)	75, 189, 266, 605
BlpI	GCTNAGC	2 cut(s)	784, 825
Bme1390I	CCNGG	1 cut(s)	475
BmeT110I	CYCGRG	1 cut(s)	616
BmiI	GGNNCC	1 cut(s)	613
BmrFI	CCNGG	1 cut(s)	475
BmrI	ACTGGG	1 cut(s)	119
BmsI	GCATC	4 cut(s)	194, 252, 580, 701
BmuI	ACTGGG	1 cut(s)	119
BpmI	CTGGAG	1 cut(s)	782
Bpu1102I	GCTNAGC	2 cut(s)	784, 825
BsaJI	CCNNGG	3 cut(s)	474, 615, 831
Bsc4I	CCNNNNNNNGG	1 cut(s)	32
Bse118I	RCCGGY	1 cut(s)	350
Bse1I	ACTGG	1 cut(s)	114
BseBI	CCWGG	1 cut(s)	475
BseDI	CCNNGG	3 cut(s)	474, 615, 831
BseGI	GGATG	2 cut(s)	571, 868
BseLI	CCNNNNNNNGG	1 cut(s)	32
BseMII	CTCAG	2 cut(s)	798, 839
BseNI	ACTGG	1 cut(s)	114
BseYI	CCCAGC	4 cut(s)	31, 205, 678, 858
BsiHKAI	GWGCWC	1 cut(s)	432
BsiHKCI	CYCGRG	1 cut(s)	616
BsiSI	CCGG	1 cut(s)	351
BslI	CCNNNNNNNGG	1 cut(s)	32
BsoBI	CYCGRG	1 cut(s)	616
Bsp1286I	GDGCHC	1 cut(s)	432
Bsp1720I	GCTNAGC	2 cut(s)	784, 825
BspACI	CCGC	3 cut(s)	7, 285, 550
BspCNI	CTCAG	2 cut(s)	797, 838
BspLI	GGNNCC	1 cut(s)	613
BspQI	GCTCTTC	1 cut(s)	195
BsrFI	RCCGGY	1 cut(s)	350
BsrI	ACTGG	1 cut(s)	114
BssAI	RCCGGY	1 cut(s)	350
BssECI	CCNNGG	3 cut(s)	474, 615, 831
BssT1I	CCWWGG	1 cut(s)	831
Bst2UI	CCWGG	1 cut(s)	475
Bst4CI	ACNGT	1 cut(s)	381
Bst6I	CTCTTC	2 cut(s)	195, 238
BstC8I	GCNNGC	1 cut(s)	343
BstDEI	CTNAG	2 cut(s)	784, 825
BstF5I	GGATG	2 cut(s)	571, 868
BstHHI	GCGC	1 cut(s)	257
BstMWI	GCNNNNNNNGC	2 cut(s)	13, 347
BstNI	CCWGG	1 cut(s)	475
BstNSI	RCATGY	1 cut(s)	345
BstSCI	CCNGG	1 cut(s)	473
BtsCI	GGATG	2 cut(s)	571, 868
BtsIMutI	CAGTG	1 cut(s)	386
Cac8I	GCNNGC	1 cut(s)	343
CfoI	GCGC	1 cut(s)	257
Cfr10I	RCCGGY	1 cut(s)	350
Csp6I	GTAC	1 cut(s)	321
CviAII	CATG	5 cut(s)	129, 194, 342, 365, 447
CviQI	GTAC	1 cut(s)	321
DdeI	CTNAG	2 cut(s)	784, 825
DraI	TTTAAA	1 cut(s)	166
Eam1104I	CTCTTC	2 cut(s)	195, 238
EarI	CTCTTC	2 cut(s)	195, 238
EciI	GGCGGA	1 cut(s)	565
Ecl136II	GAGCTC	1 cut(s)	430
Eco130I	CCWWGG	1 cut(s)	831
Eco24I	GRGCYC	1 cut(s)	432
Eco32I	GATATC	1 cut(s)	804
Eco53kI	GAGCTC	1 cut(s)	430
Eco88I	CYCGRG	1 cut(s)	616
EcoICRI	GAGCTC	1 cut(s)	430
EcoRII	CCWGG	1 cut(s)	473
EcoRV	GATATC	1 cut(s)	804
EcoT14I	CCWWGG	1 cut(s)	831
EcoT22I	ATGCAT	2 cut(s)	347, 452
EcoT38I	GRGCYC	1 cut(s)	432
ErhI	CCWWGG	1 cut(s)	831
FaeI	CATG	5 cut(s)	132, 197, 345, 368, 450
FalI	AAGNNNNNCTT	2 cut(s)	235, 267
FatI	CATG	5 cut(s)	128, 193, 341, 364, 446
FokI	GGATG	2 cut(s)	558, 875
FriOI	GRGCYC	1 cut(s)	432
FspBI	CTAG	4 cut(s)	75, 189, 266, 605
GlaI	GCGC	1 cut(s)	256
GsaI	CCCAGC	4 cut(s)	35, 209, 682, 862
GsuI	CTGGAG	1 cut(s)	782
HapII	CCGG	1 cut(s)	351
HhaI	GCGC	1 cut(s)	257
Hin1II	CATG	5 cut(s)	132, 197, 345, 368, 450
Hin6I	GCGC	1 cut(s)	255
HinP1I	GCGC	1 cut(s)	255
HincII	GTYRAC	1 cut(s)	769
HindII	GTYRAC	1 cut(s)	769
HinfI	GANTC	4 cut(s)	98, 149, 590, 722
HpaII	CCGG	1 cut(s)	351
HphI	GGTGA	3 cut(s)	410, 717, 908
Hpy166II	GTNNAC	2 cut(s)	769, 775
Hpy188I	TCNGA	4 cut(s)	103, 261, 412, 710
Hpy188III	TCNNGA	4 cut(s)	84, 315, 386, 799
Hpy8I	GTNNAC	2 cut(s)	769, 775
HpyAV	CCTTC	5 cut(s)	383, 470, 497, 608, 814
HpyCH4III	ACNGT	1 cut(s)	381
HpyCH4IV	ACGT	3 cut(s)	319, 515, 771
HpyCH4V	TGCA	6 cut(s)	122, 341, 345, 450, 483, 587
HpyF10VI	GCNNNNNNNGC	2 cut(s)	13, 347
HpyF3I	CTNAG	2 cut(s)	784, 825
HpySE526I	ACGT	3 cut(s)	319, 515, 771
Hsp92II	CATG	5 cut(s)	132, 197, 345, 368, 450
HspAI	GCGC	1 cut(s)	255
LguI	GCTCTTC	1 cut(s)	195
LmnI	GCTCC	1 cut(s)	435
LweI	GCATC	4 cut(s)	194, 252, 580, 701
MaeI	CTAG	4 cut(s)	75, 189, 266, 605
MaeII	ACGT	3 cut(s)	319, 515, 771
MboII	GAAGA	5 cut(s)	71, 212, 255, 565, 666
MfeI	CAATTG	1 cut(s)	914
MhlI	GDGCHC	1 cut(s)	432
MluCI	AATT	8 cut(s)	104, 123, 401, 423, 625, 653, 904, 914
MlyI	GAGTC	2 cut(s)	92, 716
MmeI	TCCRAC	1 cut(s)	220
MnlI	CCTC	6 cut(s)	174, 559, 625, 658, 738, 806
Mph1103I	ATGCAT	2 cut(s)	347, 452
MseI	TTAA	2 cut(s)	165, 437
MslI	CAYNNNNRTG	2 cut(s)	340, 363
MspA1I	CMGCKG	1 cut(s)	326
MspI	CCGG	1 cut(s)	351
MspR9I	CCNGG	1 cut(s)	475
MunI	CAATTG	1 cut(s)	914
MvaI	CCWGG	1 cut(s)	475
MwoI	GCNNNNNNNGC	2 cut(s)	13, 347
NlaIII	CATG	5 cut(s)	132, 197, 345, 368, 450
NlaIV	GGNNCC	1 cut(s)	613
NsiI	ATGCAT	2 cut(s)	347, 452
NspI	RCATGY	1 cut(s)	345
PaeI	GCATGC	1 cut(s)	345
PciSI	GCTCTTC	1 cut(s)	195
PfeI	GAWTC	2 cut(s)	149, 590
PflFI	GACNNNGTC	1 cut(s)	381
PleI	GAGTC	2 cut(s)	92, 716
PpsI	GAGTC	2 cut(s)	92, 716
Psp124BI	GAGCTC	1 cut(s)	432
Psp1406I	AACGTT	1 cut(s)	515
Psp6I	CCWGG	1 cut(s)	473
PspFI	CCCAGC	4 cut(s)	31, 205, 678, 858
PspGI	CCWGG	1 cut(s)	473
PspN4I	GGNNCC	1 cut(s)	613
PsyI	GACNNNGTC	1 cut(s)	381
PvuII	CAGCTG	1 cut(s)	326
RsaI	GTAC	1 cut(s)	322
RsaNI	GTAC	1 cut(s)	321
RseI	CAYNNNNRTG	2 cut(s)	340, 363
SacI	GAGCTC	1 cut(s)	432
SapI	GCTCTTC	1 cut(s)	195
SaqAI	TTAA	2 cut(s)	165, 437
SchI	GAGTC	2 cut(s)	92, 716
ScrFI	CCNGG	1 cut(s)	475
SduI	GDGCHC	1 cut(s)	432
SfaNI	GCATC	4 cut(s)	194, 252, 580, 701
SmiMI	CAYNNNNRTG	2 cut(s)	340, 363
SphI	GCATGC	1 cut(s)	345
Sse9I	AATT	8 cut(s)	104, 123, 401, 423, 625, 653, 904, 914
SsiI	CCGC	3 cut(s)	7, 285, 550
SspI	AATATT	1 cut(s)	233
SspMI	CTAG	4 cut(s)	75, 189, 266, 605
SstI	GAGCTC	1 cut(s)	432
StyD4I	CCNGG	1 cut(s)	473
StyI	CCWWGG	1 cut(s)	831
TaaI	ACNGT	1 cut(s)	381
TaiI	ACGT	3 cut(s)	322, 518, 774
TaqI	TCGA	2 cut(s)	469, 810
TasI	AATT	8 cut(s)	104, 123, 401, 423, 625, 653, 904, 914
TfiI	GAWTC	2 cut(s)	149, 590
Tru1I	TTAA	2 cut(s)	165, 437
Tru9I	TTAA	2 cut(s)	165, 437
TscAI	CASTG	1 cut(s)	386
TspDTI	ATGAA	6 cut(s)	72, 117, 414, 621, 716, 742
TspRI	CASTG	1 cut(s)	386
Tth111I	GACNNNGTC	1 cut(s)	381
XceI	RCATGY	1 cut(s)	345
XspI	CTAG	4 cut(s)	75, 189, 266, 605
Zsp2I	ATGCAT	2 cut(s)	347, 452

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.