Rmu_sc0015474.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015474.1
OG0006703
Physical Location & Seq
Reverse (-)
177 .. 943
767 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015474.1_g000001.1.cds

Sequence Viewer

Length: 573 bp
atggcagatccaatctccttcaccgcgaggtcatcggcttcgtcgcagctccgattcccggttccccatcacaacgcccccaacaaccacaggttctcgctcccaaaccctagaattgatctcagctccatagtccaagtagtcgtacaaactgaaatttatgctcaatttatagatgtcagctccaagaaaggagtcaaatttacgaatctcgatgacgaaaatcgcagaaccccaagaaatgaatctgataatgcgaagacttccgagtatgcattcttcaagaaattgaaggaagatgcaagccacaaacatcactcttgttctgaaagcaaagaggcgtaccgaggaagcaattcaaagccgagaggctgttccagagataggactactatggttaggaataagagcgacgacgtcaggtcctcagtgttcaagaaagatgtcacagaagatagctttgagtcatctcacgcactacctggtagtgcatcgagaaactcaggtattcaatgtaaagaggcagagttagatattaactgcagcaatcgatgtggcgagtattctgtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

190

Amino Acids

21.3

Weight (kDa)

8.8

Isoelectric Point (pI)

44.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 420
AccII CGCG 1 cut(s) 26
AciI CCGC 1 cut(s) 24
AclWI GGATC 1 cut(s) 2
AcsI RAATTY 2 cut(s) 156, 200
AcyI GRCGYC 1 cut(s) 417
AfaI GTAC 2 cut(s) 147, 344
AfiI CCNNNNNNNGG 2 cut(s) 58, 384
AgsI TTSAA 5 cut(s) 283, 292, 360, 436, 512
AhdI GACNNNNNGTC 1 cut(s) 421
AjnI CCWGG 1 cut(s) 481
AluBI AGCT 4 cut(s) 49, 126, 183, 459
AluI AGCT 4 cut(s) 49, 126, 183, 459
AlwI GGATC 1 cut(s) 2
ApeKI GCWGC 2 cut(s) 46, 543
ApoI RAATTY 2 cut(s) 156, 200
Asp700I GAANNNNTTC 1 cut(s) 355
AspS9I GGNCC 1 cut(s) 423
AsuC2I CCSGG 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 13
AvaII GGWCC 1 cut(s) 423
BarI GAAGNNNNNNTAC 2 cut(s) 263, 295
BbsI GAAGAC 1 cut(s) 266
BbvI GCAGC 2 cut(s) 58, 555
BccI CCATC 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 483
BcnI CCSGG 1 cut(s) 59
BfaI CTAG 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 541
BisI GCNGC 2 cut(s) 47, 544
BlsI GCNGC 2 cut(s) 48, 545
Bme1390I CCNGG 2 cut(s) 59, 483
Bme18I GGWCC 1 cut(s) 423
BmeRI GACNNNNNGTC 1 cut(s) 421
BmgT120I GGNCC 1 cut(s) 423
BmiI GGNNCC 1 cut(s) 63
BmrFI CCNGG 2 cut(s) 59, 483
BmsI GCATC 2 cut(s) 289, 500
BpiI GAAGAC 1 cut(s) 266
BpuMI CCSGG 1 cut(s) 59
Bsa29I ATCGAT 1 cut(s) 550
BsaHI GRCGYC 1 cut(s) 417
BsaJI CCNNGG 1 cut(s) 346
Bsc4I CCNNNNNNNGG 2 cut(s) 58, 384
BseBI CCWGG 1 cut(s) 483
BseCI ATCGAT 1 cut(s) 550
BseDI CCNNGG 1 cut(s) 346
BseLI CCNNNNNNNGG 2 cut(s) 58, 384
BseMII CTCAG 3 cut(s) 136, 441, 516
BseXI GCAGC 2 cut(s) 58, 555
Bsh1236I CGCG 1 cut(s) 26
BshVI ATCGAT 1 cut(s) 550
BsiSI CCGG 1 cut(s) 59
BslI CCNNNNNNNGG 2 cut(s) 58, 384
BsmI GAATGC 1 cut(s) 275
Bsp143I GATC 2 cut(s) 7, 118
BspACI CCGC 1 cut(s) 24
BspCNI CTCAG 3 cut(s) 135, 440, 515
BspDI ATCGAT 1 cut(s) 550
BspFNI CGCG 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 63
BspMAI CTGCAG 1 cut(s) 545
BspPI GGATC 1 cut(s) 2
BssECI CCNNGG 1 cut(s) 346
BssMI GATC 2 cut(s) 7, 118
BssNI GRCGYC 1 cut(s) 417
Bst2UI CCWGG 1 cut(s) 483
BstACI GRCGYC 1 cut(s) 417
BstC8I GCNNGC 1 cut(s) 304
BstDEI CTNAG 3 cut(s) 122, 427, 502
BstFNI CGCG 1 cut(s) 26
BstKTI GATC 2 cut(s) 10, 121
BstMBI GATC 2 cut(s) 7, 118
BstNI CCWGG 1 cut(s) 483
BstSCI CCNGG 2 cut(s) 57, 481
BstSFI CTRYAG 1 cut(s) 541
BstUI CGCG 1 cut(s) 26
BstV1I GCAGC 2 cut(s) 58, 555
BstV2I GAAGAC 1 cut(s) 266
BstX2I RGATCY 1 cut(s) 7
BstYI RGATCY 1 cut(s) 7
Bsu15I ATCGAT 1 cut(s) 550
BsuTUI ATCGAT 1 cut(s) 550
BtsIMutI CAGTG 1 cut(s) 435
Cac8I GCNNGC 1 cut(s) 304
Cfr13I GGNCC 1 cut(s) 423
ClaI ATCGAT 1 cut(s) 550
CsiI ACCWGGT 1 cut(s) 481
Csp6I GTAC 2 cut(s) 146, 343
CspCI CAANNNNNGTGG 2 cut(s) 535, 570
CviJI RGCY 8 cut(s) 38, 49, 126, 183, 306, 364, 372, 459
CviKI_1 RGCY 8 cut(s) 38, 49, 126, 183, 306, 364, 372, 459
CviQI GTAC 2 cut(s) 146, 343
DdeI CTNAG 3 cut(s) 122, 427, 502
DpnI GATC 2 cut(s) 9, 120
DpnII GATC 2 cut(s) 7, 118
DriI GACNNNNNGTC 1 cut(s) 421
Eam1105I GACNNNNNGTC 1 cut(s) 421
Eco47I GGWCC 1 cut(s) 423
EcoO109I RGGNCCY 1 cut(s) 423
EcoRII CCWGG 1 cut(s) 481
EcoT22I ATGCAT 1 cut(s) 277
FaiI YATR 5 cut(s) 131, 162, 173, 273, 395
Fnu4HI GCNGC 2 cut(s) 47, 544
Fsp4HI GCNGC 2 cut(s) 47, 544
FspBI CTAG 1 cut(s) 111
GluI GCNGC 2 cut(s) 47, 544
HapII CCGG 1 cut(s) 59
Hin1I GRCGYC 1 cut(s) 417
HinfI GANTC 5 cut(s) 54, 195, 208, 245, 464
HpaII CCGG 1 cut(s) 59
HphI GGTGA 1 cut(s) 13
Hpy188I TCNGA 4 cut(s) 53, 250, 268, 328
Hpy188III TCNNGA 5 cut(s) 212, 283, 378, 436, 495
Hpy99I CGWCG 3 cut(s) 46, 416, 419
HpyAV CCTTC 2 cut(s) 28, 286
HpyCH4IV ACGT 1 cut(s) 417
HpyCH4V TGCA 4 cut(s) 275, 302, 491, 543
HpyF3I CTNAG 3 cut(s) 122, 427, 502
HpySE526I ACGT 1 cut(s) 417
Hsp92I GRCGYC 1 cut(s) 417
Kzo9I GATC 2 cut(s) 7, 118
LmnI GCTCC 4 cut(s) 54, 105, 131, 188
LpnPI CCDG 7 cut(s) 72, 76, 391, 406, 468, 489, 495
Lsp1109I GCAGC 2 cut(s) 58, 555
LweI GCATC 2 cut(s) 289, 500
MabI ACCWGGT 1 cut(s) 481
MaeI CTAG 1 cut(s) 111
MaeII ACGT 1 cut(s) 417
MaeIII GTNAC 1 cut(s) 445
MalI GATC 2 cut(s) 9, 120
MboI GATC 2 cut(s) 7, 118
MboII GAAGA 4 cut(s) 271, 271, 308, 464
MflI RGATCY 1 cut(s) 7
MluCI AATT 6 cut(s) 114, 156, 167, 200, 287, 355
MlyI GAGTC 2 cut(s) 204, 473
MnlI CCTC 6 cut(s) 21, 331, 341, 362, 436, 514
Mph1103I ATGCAT 1 cut(s) 277
MroXI GAANNNNTTC 1 cut(s) 355
MseI TTAA 1 cut(s) 537
MspI CCGG 1 cut(s) 59
MspR9I CCNGG 2 cut(s) 59, 483
Mva1269I GAATGC 1 cut(s) 275
MvaI CCWGG 1 cut(s) 483
MvnI CGCG 1 cut(s) 26
NciI CCSGG 1 cut(s) 59
NdeII GATC 2 cut(s) 7, 118
NlaIV GGNNCC 1 cut(s) 63
NmeAIII GCCGAG 1 cut(s) 390
NmuCI GTSAC 1 cut(s) 445
NsiI ATGCAT 1 cut(s) 277
PctI GAATGC 1 cut(s) 275
PdmI GAANNNNTTC 1 cut(s) 355
PfeI GAWTC 3 cut(s) 54, 208, 245
PflFI GACNNNGTC 1 cut(s) 416
PkrI GCNGC 2 cut(s) 48, 545
PleI GAGTC 2 cut(s) 203, 472
PpsI GAGTC 2 cut(s) 203, 472
PpuMI RGGWCCY 1 cut(s) 423
Psp5II RGGWCCY 1 cut(s) 423
Psp6I CCWGG 1 cut(s) 481
PspGI CCWGG 1 cut(s) 481
PspN4I GGNNCC 1 cut(s) 63
PspPI GGNCC 1 cut(s) 423
PspPPI RGGWCCY 1 cut(s) 423
PstI CTGCAG 1 cut(s) 545
PsuI RGATCY 1 cut(s) 7
PsyI GACNNNGTC 1 cut(s) 416
RsaI GTAC 2 cut(s) 147, 344
RsaNI GTAC 2 cut(s) 146, 343
SaqAI TTAA 1 cut(s) 537
SatI GCNGC 2 cut(s) 47, 544
Sau3AI GATC 2 cut(s) 7, 118
Sau96I GGNCC 1 cut(s) 423
SchI GAGTC 2 cut(s) 204, 473
ScrFI CCNGG 2 cut(s) 59, 483
SexAI ACCWGGT 1 cut(s) 481
SfaNI GCATC 2 cut(s) 289, 500
SfcI CTRYAG 1 cut(s) 541
SinI GGWCC 1 cut(s) 423
Sse9I AATT 6 cut(s) 114, 156, 167, 200, 287, 355
SsiI CCGC 1 cut(s) 24
SspMI CTAG 1 cut(s) 111
StyD4I CCNGG 2 cut(s) 57, 481
TaiI ACGT 1 cut(s) 420
TaqI TCGA 3 cut(s) 213, 494, 550
TasI AATT 6 cut(s) 114, 156, 167, 200, 287, 355
TfiI GAWTC 3 cut(s) 54, 208, 245
Tru1I TTAA 1 cut(s) 537
Tru9I TTAA 1 cut(s) 537
TscAI CASTG 1 cut(s) 435
TseFI GTSAC 1 cut(s) 445
TseI GCWGC 2 cut(s) 46, 543
Tsp45I GTSAC 1 cut(s) 445
TspDTI ATGAA 1 cut(s) 258
TspRI CASTG 1 cut(s) 435
Tth111I GACNNNGTC 1 cut(s) 416
VpaK11BI GGWCC 1 cut(s) 423
XapI RAATTY 2 cut(s) 156, 200
XmnI GAANNNNTTC 1 cut(s) 355
XspI CTAG 1 cut(s) 111
ZraI GACGTC 1 cut(s) 418
Zsp2I ATGCAT 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.