Rmu_co8441827.1_g000001

U1 small nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8441827.1
Physical Location & Seq
Forward (+)
1 .. 869
869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8441827.1_g000001.1.cds

Sequence Viewer

Length: 294 bp
ctctcccagataccatatcctggtggtgtgaaatctatggtgcctgaggcccctgctccaccaaataatattctttttgttcagaatcttcctcacgaggcaacttccgtgatgctgcaaatgctcttctgtcaataccctggttttaaggaggttagaatggtggaagctaagccaggtattgcttttgtggaatacgaaaatgagatgcaatcatcaatggcaatgcagaacctccaagcttttaaggtaacaccgcagaattcaatgttgatcacctacgcaaagaagtag

Protein Analysis

97

Amino Acids

10.87

Weight (kDa)

6.78

Isoelectric Point (pI)

43.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011967)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 40
AccB7I CCANNNNNTGG 1 cut(s) 20
AciI CCGC 1 cut(s) 257
AcsI RAATTY 1 cut(s) 262
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 1 cut(s) 267
AjnI CCWGG 3 cut(s) 19, 139, 175
AluBI AGCT 2 cut(s) 170, 242
AluI AGCT 2 cut(s) 170, 242
AoxI GGCC 1 cut(s) 48
ApeKI GCWGC 1 cut(s) 115
ApoI RAATTY 1 cut(s) 262
AspS9I GGNCC 1 cut(s) 49
AsuHPI GGTGA 1 cut(s) 268
AxyI CCTNAGG 1 cut(s) 45
BanI GGYRCC 1 cut(s) 40
BauI CACGAG 1 cut(s) 95
BbvI GCAGC 1 cut(s) 102
BciT130I CCWGG 3 cut(s) 21, 141, 177
BclI TGATCA 1 cut(s) 273
BisI GCNGC 1 cut(s) 116
BlpI GCTNAGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 117
Bme1390I CCNGG 3 cut(s) 21, 141, 177
BmgT120I GGNCC 1 cut(s) 49
BmiI GGNNCC 2 cut(s) 42, 51
BmrFI CCNGG 3 cut(s) 21, 141, 177
BmsI GCATC 2 cut(s) 102, 198
Bpu1102I GCTNAGC 1 cut(s) 171
BsaJI CCNNGG 1 cut(s) 139
Bsc4I CCNNNNNNNGG 1 cut(s) 20
Bse21I CCTNAGG 1 cut(s) 45
Bse3DI GCAATG 1 cut(s) 231
BseBI CCWGG 3 cut(s) 21, 141, 177
BseDI CCNNGG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 20
BseMI GCAATG 1 cut(s) 231
BseMII CTCAG 1 cut(s) 36
BseXI GCAGC 1 cut(s) 102
BshFI GGCC 1 cut(s) 50
BshNI GGYRCC 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 20
BsnI GGCC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 273
Bsp1720I GCTNAGC 1 cut(s) 171
BspACI CCGC 1 cut(s) 257
BspANI GGCC 1 cut(s) 50
BspCNI CTCAG 1 cut(s) 37
BspLI GGNNCC 2 cut(s) 42, 51
BspQI GCTCTTC 1 cut(s) 131
BspT107I GGYRCC 1 cut(s) 40
BsrDI GCAATG 1 cut(s) 231
BssECI CCNNGG 1 cut(s) 139
BssMI GATC 1 cut(s) 273
BssSI CACGAG 1 cut(s) 95
Bst2BI CACGAG 1 cut(s) 95
Bst2UI CCWGG 3 cut(s) 21, 141, 177
Bst6I CTCTTC 1 cut(s) 131
BstDEI CTNAG 2 cut(s) 45, 171
BstKTI GATC 1 cut(s) 276
BstMBI GATC 1 cut(s) 273
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNI CCWGG 3 cut(s) 21, 141, 177
BstSCI CCNGG 3 cut(s) 19, 139, 175
BstV1I GCAGC 1 cut(s) 102
Bsu36I CCTNAGG 1 cut(s) 45
BsuRI GGCC 1 cut(s) 50
Cfr13I GGNCC 1 cut(s) 49
CviJI RGCY 4 cut(s) 50, 170, 175, 242
CviKI_1 RGCY 4 cut(s) 50, 170, 175, 242
DdeI CTNAG 2 cut(s) 45, 171
DpnI GATC 1 cut(s) 275
DpnII GATC 1 cut(s) 273
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco81I CCTNAGG 1 cut(s) 45
EcoO109I RGGNCCY 1 cut(s) 49
EcoRI GAATTC 1 cut(s) 262
EcoRII CCWGG 3 cut(s) 19, 139, 175
FaiI YATR 2 cut(s) 16, 38
FbaI TGATCA 1 cut(s) 273
Fnu4HI GCNGC 1 cut(s) 116
Fsp4HI GCNGC 1 cut(s) 116
GluI GCNGC 1 cut(s) 116
HaeIII GGCC 1 cut(s) 50
HindIII AAGCTT 1 cut(s) 240
HinfI GANTC 1 cut(s) 85
HphI GGTGA 1 cut(s) 268
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 95
HpyCH4V TGCA 3 cut(s) 118, 211, 229
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
HpyF3I CTNAG 2 cut(s) 45, 171
Ksp22I TGATCA 1 cut(s) 273
Kzo9I GATC 1 cut(s) 273
LguI GCTCTTC 1 cut(s) 131
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 9 cut(s) 6, 20, 33, 57, 66, 126, 153, 162, 189
Lsp1109I GCAGC 1 cut(s) 102
LweI GCATC 2 cut(s) 102, 198
MaeIII GTNAC 1 cut(s) 250
MalI GATC 1 cut(s) 275
MboI GATC 1 cut(s) 273
MboII GAAGA 2 cut(s) 80, 118
MluCI AATT 1 cut(s) 262
MnlI CCTC 5 cut(s) 40, 91, 102, 145, 245
MseI TTAA 2 cut(s) 147, 246
MspR9I CCNGG 3 cut(s) 21, 141, 177
MvaI CCWGG 3 cut(s) 21, 141, 177
MwoI GCNNNNNNNGC 1 cut(s) 121
NdeII GATC 1 cut(s) 273
NlaIV GGNNCC 2 cut(s) 42, 51
PciSI GCTCTTC 1 cut(s) 131
PfeI GAWTC 1 cut(s) 85
PflMI CCANNNNNTGG 1 cut(s) 20
PkrI GCNGC 1 cut(s) 117
Psp6I CCWGG 3 cut(s) 19, 139, 175
PspGI CCWGG 3 cut(s) 19, 139, 175
PspN4I GGNNCC 2 cut(s) 42, 51
PspPI GGNCC 1 cut(s) 49
SapI GCTCTTC 1 cut(s) 131
SaqAI TTAA 2 cut(s) 147, 246
SatI GCNGC 1 cut(s) 116
Sau3AI GATC 1 cut(s) 273
Sau96I GGNCC 1 cut(s) 49
ScrFI CCNGG 3 cut(s) 21, 141, 177
SetI ASST 7 cut(s) 156, 172, 181, 237, 244, 252, 281
SfaNI GCATC 2 cut(s) 102, 198
Sse9I AATT 1 cut(s) 262
SsiI CCGC 1 cut(s) 257
SspI AATATT 1 cut(s) 70
StyD4I CCNGG 3 cut(s) 19, 139, 175
TasI AATT 1 cut(s) 262
TfiI GAWTC 1 cut(s) 85
Tru1I TTAA 2 cut(s) 147, 246
Tru9I TTAA 2 cut(s) 147, 246
TseI GCWGC 1 cut(s) 115
TspGWI ACGGA 1 cut(s) 97
Van91I CCANNNNNTGG 1 cut(s) 20
XapI RAATTY 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.