Rmu_co8444859.1_g000001

Nuclear pore complex protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8444859.1
Physical Location & Seq
Reverse (-)
1 .. 1335
1335 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8444859.1_g000001.1.cds

Sequence Viewer

Length: 1327 bp
atggcccccactgccaacactaacagcggtaacaacattgctgctactagtgccgttaccaccagcggtagcaatcattttagctcagtttcagcaccgtccttttcagccgaacctttttttaaattttcagtctctaccacaactgaggtgacacaagttccagaaaattcttccttggaatcgttaggagacaagaacaagcgagatggcagttttgctaatctaagcggcacgtcttttgctggcacatctgctatcagtgcaggcacaggaagtagctttttgggggtttctgctgctgcttcctcccctgctgctaccaatcagttgggttctacttcttttagttctggaagtggattcggtcctagtgcccaggcatcacctggattgtccttcaaatttgaaccctcaactgcttcaactgcagtaacgccaggaagttcttccttggaattcataaatgataagaacaagcaaggcgggatctttggtagtttaagcagtacctcatctgctggcacgtctgcaacaagtgcaagcacattgagtaacagttttgggttttctgctgctgcttccacacctatctttaccagtcagtcagtgggttctgctctttttagtggtggcagtggaactagttctagtgcccatgtgtcacctgctgggactggagctgcatctttcacacagagtgcacctgttcaacctggttcatcagcttccagttcggtatttaattttgcaggaaatacagctttctcttctgggagctctacacttggttcttctaccccctcttctgaagccaaccctagcagctccagtactgctccaagtactgtattcggttcttctaccccctcttccgaagccaaccctagcagttccagtactgctccaagtactgtattcggtagtgggtggcaacctgctacatcttcaaaatttgcttccacaccaaactctacatctttctcaccagcgtttcaattcggtgcatcctcagcctctgctgcaaccaacactacatctacttcatttggagcatcctcgacttctgctgctacttctaacagtgcagccacagtatttggaatgtcctccgcttctgctcctacgtccaacagtttgcctactttgtttggagcatccacagtttcttctccaagtaccaacagcgcatcggtgtttggattgtccaatggtgcatcatcaaccagcatgttcccctttacatcatctgccactactactaccccatcacagcctgcatttggtaactccaactctatatttggcttccctacagctccctcgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families
No domains found.

Protein Analysis

442

Amino Acids

42.51

Weight (kDa)

5.24

Isoelectric Point (pI)

46.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 676
Acc36I ACCTGC 2 cut(s) 676, 946
AciI CCGC 5 cut(s) 27, 66, 231, 486, 1113
AclWI GGATC 1 cut(s) 497
AcsI RAATTY 5 cut(s) 125, 169, 404, 458, 953
AcuI CTGAAG 1 cut(s) 831
AdeI CACNNNGTG 1 cut(s) 701
AfaI GTAC 6 cut(s) 511, 835, 847, 901, 913, 1180
AfiI CCNNNNNNNGG 1 cut(s) 1283
AgsI TTSAA 6 cut(s) 403, 410, 426, 713, 951, 998
AhlI ACTAGT 2 cut(s) 47, 644
AjiI CACGTC 2 cut(s) 237, 528
AjnI CCWGG 4 cut(s) 378, 388, 439, 715
AluBI AGCT 8 cut(s) 84, 282, 683, 728, 764, 780, 828, 1319
AluI AGCT 8 cut(s) 84, 282, 683, 728, 764, 780, 828, 1319
Alw21I GWGCWC 2 cut(s) 706, 782
Alw26I GTCTC 2 cut(s) 139, 186
Alw44I GTGCAC 1 cut(s) 702
AlwI GGATC 1 cut(s) 497
AlwNI CAGNNNCTG 1 cut(s) 1019
AoxI GGCC 1 cut(s) 3
ApaLI GTGCAC 1 cut(s) 702
ApoI RAATTY 5 cut(s) 125, 169, 404, 458, 953
Asp700I GAANNNNTTC 2 cut(s) 448, 646
AspLEI GCGC 1 cut(s) 1190
AspS9I GGNCC 2 cut(s) 4, 368
AsuHPI GGTGA 4 cut(s) 163, 378, 657, 978
AvaII GGWCC 1 cut(s) 368
BaeGI GKGCMC 3 cut(s) 379, 658, 706
BanII GRGCYC 1 cut(s) 782
Bbv12I GWGCWC 2 cut(s) 706, 782
BbvCI CCTCAGC 1 cut(s) 1012
BccI CCATC 2 cut(s) 203, 1276
BceAI ACGGC 1 cut(s) 38
BciT130I CCWGG 4 cut(s) 380, 390, 441, 717
BcoDI GTCTC 2 cut(s) 139, 186
BcuI ACTAGT 2 cut(s) 47, 644
BfaI CTAG 6 cut(s) 48, 372, 645, 651, 822, 888
BfmI CTRYAG 2 cut(s) 429, 1314
BfuAI ACCTGC 2 cut(s) 676, 946
BmcAI AGTACT 4 cut(s) 835, 847, 901, 913
Bme1390I CCNGG 4 cut(s) 380, 390, 441, 717
Bme18I GGWCC 1 cut(s) 368
BmgBI CACGTC 2 cut(s) 237, 528
BmgT120I GGNCC 2 cut(s) 4, 368
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 4 cut(s) 380, 390, 441, 717
BmsI GCATC 7 cut(s) 392, 695, 1016, 1064, 1166, 1199, 1226
BpmI CTGGAG 2 cut(s) 699, 814
Bpu10I CCTNAGC 1 cut(s) 1012
BsaJI CCNNGG 4 cut(s) 177, 378, 453, 1323
Bsc4I CCNNNNNNNGG 1 cut(s) 1283
Bse1I ACTGG 5 cut(s) 600, 682, 732, 831, 897
Bse3DI GCAATG 1 cut(s) 36
BseBI CCWGG 4 cut(s) 380, 390, 441, 717
BseDI CCNNGG 4 cut(s) 177, 378, 453, 1323
BseGI GGATG 3 cut(s) 1007, 1055, 1157
BseLI CCNNNNNNNGG 1 cut(s) 1283
BseMI GCAATG 1 cut(s) 36
BseMII CTCAG 3 cut(s) 99, 138, 1026
BseNI ACTGG 5 cut(s) 600, 682, 732, 831, 897
BseSI GKGCMC 3 cut(s) 379, 658, 706
BseYI CCCAGC 1 cut(s) 671
BsgI GTGCAG 2 cut(s) 285, 1107
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 2 cut(s) 706, 782
BslFI GGGAC 1 cut(s) 688
BslI CCNNNNNNNGG 1 cut(s) 1283
BsmAI GTCTC 2 cut(s) 139, 186
BsmFI GGGAC 1 cut(s) 688
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 4 cut(s) 379, 658, 706, 782
Bsp143I GATC 1 cut(s) 489
BspACI CCGC 5 cut(s) 27, 66, 231, 486, 1113
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 3 cut(s) 98, 139, 1025
BspLI GGNNCC 1 cut(s) 6
BspMAI CTGCAG 1 cut(s) 433
BspMI ACCTGC 2 cut(s) 676, 946
BspPI GGATC 1 cut(s) 497
BsrDI GCAATG 1 cut(s) 36
BsrI ACTGG 5 cut(s) 600, 682, 732, 831, 897
BssECI CCNNGG 4 cut(s) 177, 378, 453, 1323
BssMI GATC 1 cut(s) 489
BssT1I CCWWGG 2 cut(s) 177, 453
Bst2UI CCWGG 4 cut(s) 380, 390, 441, 717
Bst4CI ACNGT 8 cut(s) 99, 560, 850, 916, 1085, 1096, 1136, 1165
Bst6I CTCTTC 3 cut(s) 775, 811, 877
BstAPI GCANNNNNTGC 1 cut(s) 539
BstC8I GCNNGC 5 cut(s) 247, 268, 523, 544, 1278
BstDEI CTNAG 4 cut(s) 85, 147, 227, 1012
BstF5I GGATG 3 cut(s) 1007, 1055, 1157
BstHHI GCGC 1 cut(s) 1190
BstKTI GATC 1 cut(s) 492
BstMAI GTCTC 2 cut(s) 139, 186
BstMBI GATC 1 cut(s) 489
BstMWI GCNNNNNNNGC 7 cut(s) 11, 50, 263, 428, 539, 1013, 1022
BstNI CCWGG 4 cut(s) 380, 390, 441, 717
BstNSI RCATGY 1 cut(s) 1234
BstSCI CCNGG 4 cut(s) 378, 388, 439, 715
BstSFI CTRYAG 2 cut(s) 429, 1314
BstSLI GKGCMC 3 cut(s) 379, 658, 706
BstX2I RGATCY 1 cut(s) 489
BstXI CCANNNNNNTGG 1 cut(s) 331
BstYI RGATCY 1 cut(s) 489
BsuRI GGCC 1 cut(s) 5
BtrI CACGTC 2 cut(s) 237, 528
BtsCI GGATG 3 cut(s) 1007, 1055, 1157
BtsI GCAGTG 2 cut(s) 9, 643
BtsIMutI CAGTG 5 cut(s) 9, 268, 615, 643, 1090
BveI ACCTGC 2 cut(s) 676, 946
Cac8I GCNNGC 5 cut(s) 247, 268, 523, 544, 1278
CaiI CAGNNNCTG 1 cut(s) 1019
CfoI GCGC 1 cut(s) 1190
Cfr13I GGNCC 2 cut(s) 4, 368
CsiI ACCWGGT 1 cut(s) 715
Csp6I GTAC 6 cut(s) 510, 834, 846, 900, 912, 1179
CspCI CAANNNNNGTGG 2 cut(s) 1081, 1116
CviAII CATG 2 cut(s) 659, 1231
CviQI GTAC 6 cut(s) 510, 834, 846, 900, 912, 1179
DdeI CTNAG 4 cut(s) 85, 147, 227, 1012
DpnI GATC 1 cut(s) 491
DpnII GATC 1 cut(s) 489
DraI TTTAAA 1 cut(s) 124
DraIII CACNNNGTG 1 cut(s) 701
Eam1104I CTCTTC 3 cut(s) 775, 811, 877
EarI CTCTTC 3 cut(s) 775, 811, 877
Ecl136II GAGCTC 1 cut(s) 780
Eco130I CCWWGG 2 cut(s) 177, 453
Eco24I GRGCYC 1 cut(s) 782
Eco47I GGWCC 1 cut(s) 368
Eco53kI GAGCTC 1 cut(s) 780
Eco57I CTGAAG 1 cut(s) 831
EcoICRI GAGCTC 1 cut(s) 780
EcoRI GAATTC 1 cut(s) 458
EcoRII CCWGG 4 cut(s) 378, 388, 439, 715
EcoT14I CCWWGG 2 cut(s) 177, 453
EcoT38I GRGCYC 1 cut(s) 782
ErhI CCWWGG 2 cut(s) 177, 453
FaeI CATG 2 cut(s) 662, 1234
FaiI YATR 4 cut(s) 464, 660, 1232, 1301
FaqI GGGAC 1 cut(s) 688
FatI CATG 2 cut(s) 658, 1230
FauI CCCGC 1 cut(s) 479
FokI GGATG 3 cut(s) 994, 1042, 1144
FriOI GRGCYC 1 cut(s) 782
FspBI CTAG 6 cut(s) 48, 372, 645, 651, 822, 888
GlaI GCGC 1 cut(s) 1189
GsaI CCCAGC 1 cut(s) 675
GsuI CTGGAG 2 cut(s) 699, 814
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 1190
Hin1II CATG 2 cut(s) 662, 1234
Hin6I GCGC 1 cut(s) 1188
HinP1I GCGC 1 cut(s) 1188
HinfI GANTC 2 cut(s) 182, 363
HphI GGTGA 4 cut(s) 163, 378, 657, 978
Hpy166II GTNNAC 1 cut(s) 704
Hpy188I TCNGA 2 cut(s) 811, 877
Hpy188III TCNNGA 2 cut(s) 164, 354
Hpy8I GTNNAC 1 cut(s) 704
HpyAV CCTTC 1 cut(s) 409
HpyCH4III ACNGT 8 cut(s) 99, 560, 850, 916, 1085, 1096, 1136, 1165
HpyCH4IV ACGT 3 cut(s) 236, 527, 1127
HpyF10VI GCNNNNNNNGC 7 cut(s) 11, 50, 263, 428, 539, 1013, 1022
HpyF3I CTNAG 4 cut(s) 85, 147, 227, 1012
HpySE526I ACGT 3 cut(s) 236, 527, 1127
Hsp92II CATG 2 cut(s) 662, 1234
HspAI GCGC 1 cut(s) 1188
Kzo9I GATC 1 cut(s) 489
LmnI GCTCC 9 cut(s) 680, 777, 833, 844, 910, 1052, 1126, 1154, 1324
LweI GCATC 7 cut(s) 392, 695, 1016, 1064, 1166, 1199, 1226
MabI ACCWGGT 1 cut(s) 715
MaeI CTAG 6 cut(s) 48, 372, 645, 651, 822, 888
MaeII ACGT 3 cut(s) 236, 527, 1127
MaeIII GTNAC 7 cut(s) 29, 55, 151, 433, 554, 663, 1286
MalI GATC 1 cut(s) 491
MboI GATC 1 cut(s) 489
MboII GAAGA 9 cut(s) 165, 441, 762, 786, 798, 852, 864, 939, 1161
MflI RGATCY 1 cut(s) 489
MhlI GDGCHC 4 cut(s) 379, 658, 706, 782
MluCI AATT 7 cut(s) 125, 169, 404, 458, 745, 953, 998
MmeI TCCRAC 2 cut(s) 1155, 1317
MroXI GAANNNNTTC 2 cut(s) 448, 646
MseI TTAA 3 cut(s) 123, 503, 744
MspA1I CMGCKG 2 cut(s) 27, 66
MspR9I CCNGG 4 cut(s) 380, 390, 441, 717
MvaI CCWGG 4 cut(s) 380, 390, 441, 717
MwoI GCNNNNNNNGC 7 cut(s) 11, 50, 263, 428, 539, 1013, 1022
NdeII GATC 1 cut(s) 489
NlaIII CATG 2 cut(s) 662, 1234
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 2 cut(s) 151, 663
NspI RCATGY 1 cut(s) 1234
PaqCI CACCTGC 1 cut(s) 676
PdmI GAANNNNTTC 2 cut(s) 448, 646
PfeI GAWTC 2 cut(s) 182, 363
Psp124BI GAGCTC 1 cut(s) 782
Psp6I CCWGG 4 cut(s) 378, 388, 439, 715
PspFI CCCAGC 1 cut(s) 671
PspGI CCWGG 4 cut(s) 378, 388, 439, 715
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 2 cut(s) 4, 368
PstI CTGCAG 1 cut(s) 433
PstNI CAGNNNCTG 1 cut(s) 1019
PsuI RGATCY 1 cut(s) 489
RsaI GTAC 6 cut(s) 511, 835, 847, 901, 913, 1180
RsaNI GTAC 6 cut(s) 510, 834, 846, 900, 912, 1179
SacI GAGCTC 1 cut(s) 782
SaqAI TTAA 3 cut(s) 123, 503, 744
Sau3AI GATC 1 cut(s) 489
Sau96I GGNCC 2 cut(s) 4, 368
ScaI AGTACT 4 cut(s) 835, 847, 901, 913
ScrFI CCNGG 4 cut(s) 380, 390, 441, 717
SduI GDGCHC 4 cut(s) 379, 658, 706, 782
SexAI ACCWGGT 1 cut(s) 715
SfaNI GCATC 7 cut(s) 392, 695, 1016, 1064, 1166, 1199, 1226
SfcI CTRYAG 2 cut(s) 429, 1314
SinI GGWCC 1 cut(s) 368
SpeI ACTAGT 2 cut(s) 47, 644
Sse9I AATT 7 cut(s) 125, 169, 404, 458, 745, 953, 998
SsiI CCGC 5 cut(s) 27, 66, 231, 486, 1113
SspMI CTAG 6 cut(s) 48, 372, 645, 651, 822, 888
SstI GAGCTC 1 cut(s) 782
StyD4I CCNGG 4 cut(s) 378, 388, 439, 715
StyI CCWWGG 2 cut(s) 177, 453
TaaI ACNGT 8 cut(s) 99, 560, 850, 916, 1085, 1096, 1136, 1165
TaiI ACGT 3 cut(s) 239, 530, 1130
TaqI TCGA 1 cut(s) 1061
TaqII GACCGA 1 cut(s) 356
TasI AATT 7 cut(s) 125, 169, 404, 458, 745, 953, 998
TatI WGTACW 4 cut(s) 833, 845, 899, 911
TauI GCSGC 1 cut(s) 234
TfiI GAWTC 2 cut(s) 182, 363
Tru1I TTAA 3 cut(s) 123, 503, 744
Tru9I TTAA 3 cut(s) 123, 503, 744
TscAI CASTG 5 cut(s) 16, 268, 615, 643, 1090
TseFI GTSAC 2 cut(s) 151, 663
Tsp45I GTSAC 2 cut(s) 151, 663
TspDTI ATGAA 3 cut(s) 451, 711, 1035
TspRI CASTG 5 cut(s) 16, 268, 615, 643, 1090
VneI GTGCAC 1 cut(s) 702
VpaK11BI GGWCC 1 cut(s) 368
XapI RAATTY 5 cut(s) 125, 169, 404, 458, 953
XceI RCATGY 1 cut(s) 1234
XcmI CCANNNNNNNNNTGG 2 cut(s) 386, 607
XmnI GAANNNNTTC 2 cut(s) 448, 646
XspI CTAG 6 cut(s) 48, 372, 645, 651, 822, 888
ZrmI AGTACT 4 cut(s) 835, 847, 901, 913
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.